G201641


Basic Information

Item Value
gene id G201641
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 4545893 ~ 4546137 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU228832
AGCAAGGTCCATAAAGACATGGATGAGCGAGTTTGGTGTGGAGGAACTTGACTGGCCTGCACAGAGTCCTGACCTCAACCCGATAGAACACCTTTGGGATGAATTAGAGCGGAGACTGCGAGCCAGGCCTTCTCGTCCAACATCACTGCCTGACCTCACAAATGCGCTTCTAGAAGAATGGTCAAAAATTCCCATAAACACACTCCTAAACCTTGTGGAAAGCCTTCCCAGAAGAGTTGAGGCTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU228832 True 245 lncRNA 0.50 1 4545893 4546137

Neighbor

gene id symbol gene type direction distance location
CI01000047_04471595_04476690 SGCA coding upstream 68676 4471125 ~ 4477217 (+)
CI01000047_04222867_04253291 NA coding upstream 292182 4222682 ~ 4253711 (+)
CI01000047_04214987_04217836 VPS25 coding upstream 327416 4214987 ~ 4218477 (+)
CI01000047_04198702_04207295 FAM57B, FAM57BB coding upstream 338488 4198702 ~ 4207405 (+)
CI01000047_04183386_04192887 MAZ coding upstream 352867 4183386 ~ 4193026 (+)
CI01000047_04582184_04586359 TMEM101 coding downstream 35867 4582004 ~ 4586796 (+)
CI01000047_04606043_04610846 G6PC3 coding downstream 59906 4606043 ~ 4611322 (+)
CI01000047_04663268_04663847 NA coding downstream 116178 4662315 ~ 4663996 (+)
CI01000047_04678392_04690824 NA coding downstream 131855 4677992 ~ 4691097 (+)
CI01000047_04826817_04834995 NA coding downstream 280680 4826817 ~ 4835216 (+)
G201639 NA non-coding upstream 5392 4540299 ~ 4540501 (+)
G201599 NA non-coding upstream 65115 4415813 ~ 4482457 (+)
G201613 NA non-coding upstream 120478 4420184 ~ 4425415 (+)
G201609 NA non-coding upstream 137121 4408518 ~ 4408772 (+)
G201555 NA non-coding upstream 196119 4286779 ~ 4349774 (+)
G201642 NA non-coding downstream 1115 4547252 ~ 4547455 (+)
G201600 NA non-coding downstream 27231 4573368 ~ 4596630 (+)
G201607 NA non-coding downstream 28198 4574335 ~ 4576940 (+)
G201605 NA non-coding downstream 54161 4600298 ~ 4603661 (+)
G201658 NA non-coding downstream 73814 4619951 ~ 4623509 (+)
G201387 NA other upstream 844033 3696516 ~ 3701860 (+)
G201186 NA other upstream 1457706 3018705 ~ 3088187 (+)
G200076 NA other upstream 1967896 2520596 ~ 2577997 (+)
G200003 NA other upstream 2226931 2316863 ~ 2318962 (+)
G202382 NA other downstream 2269580 6815717 ~ 6816118 (+)

Expression


Co-expression Network