G201869


Basic Information

Item Value
gene id G201869
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 5119350 ~ 5119644 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU229078
CTTCAGTGTAAACGCCCACTGCTGTGATTGGCTGACATCTTTGCAAATTAAATAAGTATTACATGTGGAATCATTTAGAATACTTTTACCACATTTTTACTATTACAGCTGTCAAGATTAACGAATCGTGAAAAGTTTTGATTATTGCATTATATTTAGATCCATTCCTATCACATGGAAGGTTGCAGTGATGAGCATTGAGCAGATGACAGTCTGTTGATCGCGTGAATGCAGTGAACGCAATTTCTGCACTCTCACCAAATGCTTTTACCATAACTAACAATGCAAACACGGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU229078 True 295 lncRNA 0.37 1 5119350 5119644

Neighbor

gene id symbol gene type direction distance location
CI01000047_05104311_05105437 RASD1 coding upstream 13453 5104201 ~ 5105897 (+)
CI01000047_05080583_05091592 NA coding upstream 27385 5079334 ~ 5091965 (+)
CI01000047_05058628_05074146 NA coding upstream 44976 5058343 ~ 5074374 (+)
CI01000047_04890965_04891981 NA coding upstream 227219 4890965 ~ 4892131 (+)
CI01000047_04845691_04876128 LMF1 coding upstream 243222 4845691 ~ 4876128 (+)
CI01000047_05159134_05162486 NA coding downstream 37561 5157205 ~ 5162595 (+)
CI01000047_05185698_05212150 USP22 coding downstream 66054 5185698 ~ 5212224 (+)
CI01000047_05267807_05269108 NA coding downstream 148163 5267807 ~ 5269150 (+)
CI01000047_05315990_05318854 NA coding downstream 195940 5315584 ~ 5320411 (+)
CI01000047_05339574_05340802 NA coding downstream 218041 5337685 ~ 5340872 (+)
G201863 NA non-coding upstream 9148 5109988 ~ 5110202 (+)
G201848 NA non-coding upstream 10175 5108524 ~ 5109175 (+)
G201847 NA non-coding upstream 21369 5097585 ~ 5097981 (+)
G201856 NA non-coding upstream 46193 5072687 ~ 5073157 (+)
G201728 NA non-coding upstream 153500 4961445 ~ 4965850 (+)
CI01000047_05468225_05478050 NA non-coding downstream 273787 5467089 ~ 5479506 (+)
G201959 NA non-coding downstream 406158 5525802 ~ 5625106 (+)
G202021 NA non-coding downstream 512571 5632215 ~ 5632418 (+)
G202030 NA non-coding downstream 530722 5650366 ~ 5650573 (+)
G202033 NA non-coding downstream 535104 5654748 ~ 5655020 (+)
G201599 NA other upstream 636893 4415813 ~ 4482457 (+)
G201387 NA other upstream 1417490 3696516 ~ 3701860 (+)
G201186 NA other upstream 2031163 3018705 ~ 3088187 (+)
G200076 NA other upstream 2541353 2520596 ~ 2577997 (+)
G200003 NA other upstream 2800388 2316863 ~ 2318962 (+)
G202382 NA other downstream 1696073 6815717 ~ 6816118 (+)

Expression


Co-expression Network