G203713


Basic Information

Item Value
gene id G203713
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 5644335 ~ 5644537 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU231192
GAATTTAATATAACACATTTGTTTGTTTGTTCTCTACATATGCAGCAAATCAATAGGGCATTTTGCAACTCGGGCTCATTGGAAATACCTGCCTGTGGCGACATTTCTGCAAAATATTACGTTGTGTCTCGCAAGTTTCATTACACCAAAGTCCCTTTAAAAGAAATTCTGTTCACTCTGTGGCCATATTTGCAACTCCTCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU231192 True 203 lncRNA 0.38 1 5644335 5644537

Neighbor

gene id symbol gene type direction distance location
CI01000047_05546059_05547988 SOX9A coding downstream 95979 5544781 ~ 5548356 (-)
CI01000047_05247473_05248489 SSTR5 coding downstream 395654 5246963 ~ 5248681 (-)
CI01000047_05235089_05236228 SSTR2A coding downstream 408062 5234144 ~ 5236273 (-)
CI01000047_05219313_05222967 NA coding downstream 421345 5219190 ~ 5222990 (-)
CI01000047_05151314_05157285 NT5M coding downstream 485941 5149719 ~ 5158394 (-)
CI01000047_05805272_05807974 NA coding upstream 160735 5805272 ~ 5807974 (-)
CI01000047_05862382_05868129 NA coding upstream 217288 5861825 ~ 5868679 (-)
CI01000047_05869347_05869519 NA coding upstream 224747 5869284 ~ 5869519 (-)
CI01000047_05958264_05971163 MAPK8B, MAPK8, MAPK8A coding upstream 313354 5957891 ~ 5971163 (-)
CI01000047_06139714_06142702 UBTD1, UBTD1A, UBTD1B coding upstream 495080 6139617 ~ 6142702 (-)
G203712 NA non-coding downstream 1368 5642745 ~ 5642967 (-)
G203709 NA non-coding downstream 5682 5638443 ~ 5638653 (-)
G203576 NA non-coding downstream 250998 5393098 ~ 5393337 (-)
G203574 NA non-coding downstream 253323 5390722 ~ 5391012 (-)
G203417 NA non-coding downstream 256292 5387092 ~ 5388043 (-)
G203719 NA non-coding upstream 8208 5652745 ~ 5652958 (-)
G203720 NA non-coding upstream 8480 5653017 ~ 5654088 (-)
G203752 NA non-coding upstream 106264 5750801 ~ 5953288 (-)
G203764 NA non-coding upstream 158599 5803136 ~ 5804158 (-)
G203853 NA non-coding upstream 331373 5975910 ~ 5976256 (-)
G203286 NA other downstream 767601 4874379 ~ 4876734 (-)
CI01000047_04575184_04576337 GNGT2B, GNGT2 other downstream 1067370 4574335 ~ 4576342 (-)
CI01000047_04285605_04286644 COA3A other downstream 1357654 4285227 ~ 4286694 (-)
CI01000047_04213574_04213976 NA other downstream 1429905 4213409 ~ 4214085 (-)
G202944 NA other downstream 1657933 3985342 ~ 3986402 (-)
G203840 NA other upstream 273971 5918508 ~ 5927344 (-)
G203881 NA other upstream 398716 6043253 ~ 6043789 (-)

Expression


Co-expression Network