G203888


Basic Information

Item Value
gene id G203888
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 6061530 ~ 6061952 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU231398
CGAATGACCTGATGTTTTGGGACATGTGTATGAGCAAGTGAAAAAATGAATTTTTCAAATAGTTAAGAGAGAGTTAGTTACTTTGCTTCACAACCATGTGGTTCTTTGCAGGTGTCTGAATGATGTCACATCCTGTCACATGATATTGACCGCATGACTTGATCCAAAATGGTCCCTTTATATTGGTTACTCCAAATGACATCAATGAAATTCATTTTTCCGGACATTCTTTCTCATAACAAAGCAACGACTTCTACATAAAATTTTAATACCATTTTGCACTATGTTGATATATGATGTTATAAAATCATGCCAGAATAAAAAATATATACATTTATTACATTTAAAGATATTTTAATCACAAATTAAATAACAATTAATAACAATTCACCTCAGATCTTCAATAAATAAAAAGAAAACAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU231398 True 423 lncRNA 0.30 1 6061530 6061952

Neighbor

gene id symbol gene type direction distance location
CI01000047_05958264_05971163 MAPK8B, MAPK8, MAPK8A coding downstream 90367 5957891 ~ 5971163 (-)
CI01000047_05869347_05869519 NA coding downstream 192011 5869284 ~ 5869519 (-)
CI01000047_05862382_05868129 NA coding downstream 192851 5861825 ~ 5868679 (-)
CI01000047_05805272_05807974 NA coding downstream 253556 5805272 ~ 5807974 (-)
CI01000047_05546059_05547988 SOX9A coding downstream 513174 5544781 ~ 5548356 (-)
CI01000047_06139714_06142702 UBTD1, UBTD1A, UBTD1B coding upstream 77665 6139617 ~ 6142702 (-)
CI01000047_06184569_06194319 ZDHHC16 coding upstream 122120 6184072 ~ 6195664 (-)
CI01000047_06216778_06234561 FAM20A coding upstream 153674 6215626 ~ 6235272 (-)
CI01000047_06242992_06270894 NA coding upstream 180775 6242727 ~ 6272791 (-)
CI01000047_06302441_06309359 DCXR coding upstream 240489 6302441 ~ 6309359 (-)
G203884 NA non-coding downstream 5059 6055469 ~ 6056471 (-)
G203878 NA non-coding downstream 26210 6035036 ~ 6035320 (-)
G203876 NA non-coding downstream 31625 6029589 ~ 6029905 (-)
G203861 NA non-coding downstream 69441 5991777 ~ 5992089 (-)
G203859 NA non-coding downstream 76643 5984581 ~ 5984887 (-)
G203855 NA non-coding upstream 72765 6134717 ~ 6137099 (-)
G204005 NA non-coding upstream 283282 6345234 ~ 6345473 (-)
G204010 NA non-coding upstream 304423 6366375 ~ 6366652 (-)
G204012 NA non-coding upstream 312667 6374619 ~ 6414242 (-)
G204031 NA non-coding upstream 402488 6464440 ~ 6466219 (-)
G203881 NA other downstream 17741 6043253 ~ 6043789 (-)
G203840 NA other downstream 134186 5918508 ~ 5927344 (-)
G203286 NA other downstream 1184796 4874379 ~ 4876734 (-)
CI01000047_04575184_04576337 GNGT2B, GNGT2 other downstream 1484565 4574335 ~ 4576342 (-)
CI01000047_04285605_04286644 COA3A other downstream 1774849 4285227 ~ 4286694 (-)

Expression


Co-expression Network