G204167


Basic Information

Item Value
gene id G204167
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000047
NCBI id null
chromosome length 7523058
location 7284539 ~ 7285427 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU231706
GCGGTTCATCAACACCAATTGAATCGATTGACTTCCCTTACCGAGGAGCTGGTGAAAACTCTGCAGGGCCTTCGATTCAACGCCACCGAGGTTGCCACGCCACCGCCTGCGGCCTCCGCTTCGCCCAGAGGAACGCGAGAGGAGACGACAACTTCATCTGTGCCTCTACTGCGGCCAAGCTGGTCACATCAAGATCAACTGCCCCATTCGACCCACTCCGTCTAACCCAAAAGCGGTGAGTTCTCCACCTCCCACCGCTTATTCCTCTAACTGCCTCAAAATTCCCATA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU231706 True 289 lncRNA 0.56 2 7284539 7285427

Neighbor

gene id symbol gene type direction distance location
CI01000047_07137958_07149332 NA coding downstream 135207 7137384 ~ 7149332 (-)
CI01000047_07072890_07079236 GAS7B, GAS7 coding downstream 205303 7072545 ~ 7079236 (-)
CI01000047_07010651_07017023 NA coding downstream 267516 7010529 ~ 7017023 (-)
CI01000047_06993737_07007548 POLR3E coding downstream 276991 6993722 ~ 7007548 (-)
CI01000047_06978552_06982232 METTL9 coding downstream 301997 6978448 ~ 6982542 (-)
CI01000047_07350018_07350608 NA coding upstream 63704 7349131 ~ 7350844 (-)
CI01000047_07351900_07353699 NA coding upstream 66440 7351867 ~ 7353753 (-)
CI01000047_07389650_07393323 NA coding upstream 103716 7389143 ~ 7393753 (-)
CI01000047_07436294_07437420 NA coding upstream 150305 7435732 ~ 7437719 (-)
CI01000047_07445474_07451503 FOXK2 coding upstream 159432 7444859 ~ 7451503 (-)
G203935 NA non-coding downstream 156470 7120453 ~ 7128069 (-)
G204149 NA non-coding downstream 221108 7063206 ~ 7063431 (-)
G204139 NA non-coding downstream 266209 7018123 ~ 7018330 (-)
G203947 NA non-coding downstream 386387 6896001 ~ 6898152 (-)
G204129 NA non-coding downstream 391359 6892834 ~ 6893180 (-)
G204175 NA non-coding upstream 11113 7296540 ~ 7296838 (-)
G204177 NA non-coding upstream 12899 7298326 ~ 7298553 (-)
G204181 NA non-coding upstream 17619 7303046 ~ 7303290 (-)
G204182 NA non-coding upstream 20552 7305979 ~ 7306594 (-)
G204186 NA non-coding upstream 26022 7311449 ~ 7311662 (-)
G203881 NA other downstream 1240750 6043253 ~ 6043789 (-)
G203840 NA other downstream 1357195 5918508 ~ 5927344 (-)
G203286 NA other downstream 2407805 4874379 ~ 4876734 (-)
CI01000047_04575184_04576337 GNGT2B, GNGT2 other downstream 2707574 4574335 ~ 4576342 (-)
CI01000047_04285605_04286644 COA3A other downstream 2997858 4285227 ~ 4286694 (-)

Expression


Co-expression Network