CI01000049_01956684_01959474 (NT5C2B, NT5C2, NT5C2A)


Basic Information

Item Value
gene id CI01000049_01956684_01959474
gene name NT5C2B, NT5C2, NT5C2A
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000049
NCBI id null
chromosome length 9665442
location 1956684 ~ 1959474 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000049_01956684_01959474.mRNA
AAACATACCTCTTAGCCTGCCTGGTTGACTTCTTCTCAAACTGTGACCGATATTCCAGCTGTGAAACAGGCTTTAAGGATGGAGATCTCTTCATGTCCTTCAAGAGCATGTTCCAAGATGTCCGAGATGCTGTAGACTGGGTACATTTTAAGGGAACATTGAAGGAGAAAACAGTGGAAAACCTGGAGAAGTATGTTGTAAAAGATGCAAAGTTGCCATTGCTGCTGAGCCGCATGACTGAAGTCGCCAAAGTTTTCTTAGCCACCAACAGTGACTACAAATACACAGAACATGGCACTCCACACCGTCCGTGGCAATCGTACTTTGACCTCATCCTAGTGGATGCTCGAAAGCCTTTATTTTTTGGAGAGGGAACGGTTCTGAGACAGGTGGATACA

Function

symbol description
nt5c2a Predicted to enable 5'-nucleotidase activity. Human ortholog(s) of this gene implicated in hereditary spastic paraplegia 45. Orthologous to human NT5C2 (5'-nucleotidase, cytosolic II).
nt5c2b Predicted to enable 5'-nucleotidase activity. Human ortholog(s) of this gene implicated in hereditary spastic paraplegia 45. Orthologous to human NT5C2 (5'-nucleotidase, cytosolic II).
nt5c2 Enables IMP 5'-nucleotidase activity. Involved in IMP catabolic process and allantoin metabolic process. Part of cytosol. Implicated in hereditary spastic paraplegia 45.

NR:

description
5'-nucleotidase, cytosolic II

GO:

id name namespace
GO:0005575 cellular_component cellular_component

KEGG:

id description
K01081 E3.1.3.5; 5'-nucleotidase

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000049_01956684_01959474.mRNA True 398 mRNA 0.45 5 1956684 1959474

Neighbor

gene id symbol gene type direction distance location
CI01000049_01853220_01857322 DPCD coding downstream 99362 1852177 ~ 1857322 (-)
CI01000049_01782181_01783289 LBX1B coding downstream 172629 1781736 ~ 1784055 (-)
CI01000049_01773383_01778313 CENPK coding downstream 177875 1772768 ~ 1778809 (-)
CI01000049_01678202_01768140 NA coding downstream 188544 1678202 ~ 1768140 (-)
CI01000049_01549129_01580150 KCNQ5B coding downstream 376534 1548440 ~ 1580150 (-)
CI01000049_01971492_01983341 NA coding upstream 11817 1971291 ~ 1984030 (-)
CI01000049_02107910_02122886 PNPLA4 coding upstream 148262 2107736 ~ 2124286 (-)
CI01000049_02331749_02338716 NA coding upstream 371822 2331296 ~ 2338723 (-)
CI01000049_02519296_02524006 NA coding upstream 559603 2519077 ~ 2524006 (-)
CI01000049_02876185_02882477 NA coding upstream 915954 2875428 ~ 2882856 (-)
G207208 NA non-coding downstream 54544 1901093 ~ 1902140 (-)
G207235 NA non-coding downstream 138936 1817336 ~ 1817748 (-)
G207228 NA non-coding downstream 164358 1792008 ~ 1792326 (-)
G207187 NA non-coding downstream 299396 1638659 ~ 1657288 (-)
G207188 NA non-coding downstream 332368 1610986 ~ 1624316 (-)
G207272 NA non-coding upstream 21938 1981412 ~ 1981613 (-)
G207296 NA non-coding upstream 59541 2019015 ~ 2019358 (-)
G207313 NA non-coding upstream 110523 2069997 ~ 2070264 (-)
G207286 NA non-coding upstream 141804 2101278 ~ 2101705 (-)
G206938 NA other downstream 1129039 825859 ~ 827645 (-)
G206850 NA other downstream 1323489 632680 ~ 633195 (-)
G206849 NA other downstream 1325108 631143 ~ 631576 (-)
G207278 NA other upstream 27537 1987011 ~ 1988767 (-)
G209491 NA other upstream 4068615 6028089 ~ 6028469 (-)
CI01000049_08056071_08059039 TIMM10.S, TIMM10, TIMM10.L other upstream 6096159 8055633 ~ 8059179 (-)
CI01000049_08452153_08453389 CISD2 other upstream 6491668 8451142 ~ 8454233 (-)
G211175 NA other upstream 6505819 8465293 ~ 8476265 (-)

Expression


Co-expression Network