G205624



Basic Information


Item Value
gene id G205624
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000049
NCBI id null
chromosome length 9665442
location 326434 ~ 326650 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU233418
GGAAGAGGTCATAATCGAACAGGCCTTCTCCAAAGAACTGATCGAAGAGCCGGGTGGGGTAGCCCATGGTGCGTCTGATCCAGGGGTGTTGGATGGCAATATCCATAATGTCAGGCTTGGAAACTCTCAACTTCGATTAGCTAAAAGTGGACTGGCAAATCTCAGCGATTTGAGCCTGACTGTGGCTATTTGCTCCTGATGTCGAGGAAATTTTCGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU233418 True 217 lncRNA 0.49 1 326434 326650

Neighbor


gene id symbol gene type direction distance location
CI01000049_00297474_00300898 GEMIN8 coding downstream 25396 297264 ~ 301038 (-)
CI01000049_00246668_00252556 GPM6BA, GPM6BB, GPM6B coding downstream 73878 246557 ~ 252556 (-)
CI01000049_00175772_00192995 PWP2H coding downstream 133318 175712 ~ 194107 (-)
CI01000049_00062863_00075679 NA coding downstream 249902 62696 ~ 76532 (-)
CI01000049_00330959_00338938 NA coding upstream 4057 330707 ~ 341230 (-)
CI01000049_00345414_00349493 NA coding upstream 18759 345409 ~ 349655 (-)
CI01000049_00375347_00377699 NA coding upstream 48386 375036 ~ 377831 (-)
CI01000049_00400682_00411259 NA coding upstream 74017 400667 ~ 411259 (-)
CI01000049_00715243_00718107 NA coding upstream 388321 714971 ~ 719363 (-)
G205607 NA non-coding downstream 67444 258447 ~ 258990 (-)
G205594 NA non-coding downstream 104539 221674 ~ 221895 (-)
G205579 NA non-coding downstream 191910 134303 ~ 134524 (-)
G205464 NA non-coding downstream 273917 51712 ~ 52517 (-)
G205626 NA non-coding upstream 2243 328893 ~ 329165 (-)
G205628 NA non-coding upstream 3106 329756 ~ 329978 (-)
G205638 NA non-coding upstream 75865 402515 ~ 402976 (-)
G205538 NA non-coding upstream 80499 407149 ~ 409068 (-)
G205517 NA non-coding upstream 93620 420270 ~ 425652 (-)
G206849 NA other upstream 304493 631143 ~ 631576 (-)
G206850 NA other upstream 306030 632680 ~ 633195 (-)
G206938 NA other upstream 499209 825859 ~ 827645 (-)
G207278 NA other upstream 1660361 1987011 ~ 1988767 (-)
G209491 NA other upstream 5701439 6028089 ~ 6028469 (-)

Expression



Co-expression Network