G206978



Basic Information


Item Value
gene id G206978
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000049
NCBI id null
chromosome length 9665442
location 861202 ~ 861519 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU234878
CTCAAGCGTAGACAGTCACATGACGTCCCCCACCTCAAGCTGCTGTTCAATTTGCAGAATGACCAGACTGCGCTCTCCTGTGCTCAGGAGTCTGTACTCCTTAATCAAACTTGCCAAGTCCAAACTACCAAGGACACAAGTCCAAACTCACCATAATTTGTATTGCCGCCATTATGTATCCTGATCTTCAAGCAGAAGGAGCCTCTCTGGGCCAGACACTCAGAAATTGGTCAATCCACTTGTCTCTCTGTAGTCGTTACTGTCTCTCTGGACGGAAACTCTGAATGTAGTGTTTGTTAATGTCTCTCTCCTCAAAGG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU234878 True 318 lncRNA 0.47 1 861202 861519

Neighbor


gene id symbol gene type direction distance location
CI01000049_00848509_00854128 ALG11 coding downstream 7074 847658 ~ 854128 (-)
CI01000049_00841319_00845716 SPP2 coding downstream 15486 839723 ~ 845716 (-)
CI01000049_00769434_00772846 NA coding downstream 88356 769180 ~ 772846 (-)
CI01000049_00732479_00766646 NA coding downstream 94556 732479 ~ 766646 (-)
CI01000049_00720262_00721411 NA coding downstream 139791 720254 ~ 721411 (-)
CI01000049_00980509_01030584 NA coding upstream 118847 980366 ~ 1030597 (-)
CI01000049_01197359_01206811 NA coding upstream 334159 1195678 ~ 1207195 (-)
CI01000049_01247902_01262425 IGF2BP2, IGF2BP2B coding upstream 385941 1247460 ~ 1262425 (-)
CI01000049_01302622_01311542 UBAC2 coding upstream 441092 1302611 ~ 1311700 (-)
CI01000049_01340906_01399870 DACH1, DACHC coding upstream 479387 1340906 ~ 1399870 (-)
G206916 NA non-coding downstream 1320 857432 ~ 859882 (-)
G206975 NA non-coding downstream 26088 834821 ~ 835114 (-)
G206974 NA non-coding downstream 26999 833981 ~ 834203 (-)
G206973 NA non-coding downstream 28335 832320 ~ 832867 (-)
G206972 NA non-coding downstream 30727 830190 ~ 830475 (-)
G206931 NA non-coding upstream 4491 866010 ~ 867379 (-)
G206987 NA non-coding upstream 45940 907459 ~ 907768 (-)
G206991 NA non-coding upstream 53354 914873 ~ 915141 (-)
G206997 NA non-coding upstream 60608 922127 ~ 922409 (-)
G206932 NA non-coding upstream 189113 1050632 ~ 1050992 (-)
G206938 NA other downstream 33557 825859 ~ 827645 (-)
G206850 NA other downstream 228007 632680 ~ 633195 (-)
G206849 NA other downstream 229626 631143 ~ 631576 (-)
G207278 NA other upstream 1125492 1987011 ~ 1988767 (-)
G209491 NA other upstream 5166570 6028089 ~ 6028469 (-)
CI01000049_08056071_08059039 TIMM10.S, TIMM10, TIMM10.L other upstream 7194114 8055633 ~ 8059179 (-)
CI01000049_08452153_08453389 CISD2 other upstream 7589623 8451142 ~ 8454233 (-)
G211175 NA other upstream 7603774 8465293 ~ 8476265 (-)

Expression



Co-expression Network