G206324


Basic Information

Item Value
gene id G206324
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000049
NCBI id null
chromosome length 9665442
location 2077924 ~ 2078240 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU234176
AATAAATATGCTTAAAAGGGTTAGTTCACCCAAAAATGAAATTTCTGTCATTAATTACTCACACTCATGTCGTTCCACACCCGTAAGACCTTCGTACATCTTCGGATCACAAATTAAGATATTTTTGATAAAATCCGATGGCTCAGTGAGGCCTCCATTGCCAGCAAGATAATTAACACTTTCAGATGCCCAGAAAGCTACTAAAGACATATTTAAAACAGTTCATGTGACTACAGTGGTTCAACCTTACTGTTATGAAGGGACAAGAATAGCCTACTTTTTGTGTGCCAAAAAACAAAATAACGACTTTATTCAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU234176 True 317 lncRNA 0.36 1 2077924 2078240

Neighbor

gene id symbol gene type direction distance location
CI01000049_02043240_02052315 ANOS1A coding upstream 25423 2042478 ~ 2052501 (+)
CI01000049_02023778_02026778 NA coding upstream 50845 2023778 ~ 2027079 (+)
CI01000049_01984867_01987314 INAB coding upstream 89877 1984817 ~ 1988047 (+)
CI01000049_01903989_01944942 CNNM2, CNNM4, CNNM2B coding upstream 132982 1903989 ~ 1944942 (+)
CI01000049_01887038_01898993 AS3MT coding upstream 178791 1887038 ~ 1899133 (+)
CI01000049_02081249_02101569 STS coding downstream 3009 2081249 ~ 2101979 (+)
CI01000049_02226218_02227671 NA coding downstream 147978 2226218 ~ 2227734 (+)
CI01000049_02238067_02265765 PUDP, HDD1A coding downstream 159002 2237242 ~ 2266366 (+)
CI01000049_02345009_02446004 NLGN4A, NLGN4X, NLGN4 coding downstream 266769 2345009 ~ 2446004 (+)
CI01000049_02593696_02606225 NA coding downstream 515267 2593507 ~ 2606270 (+)
G206318 NA non-coding upstream 4192 2073439 ~ 2073732 (+)
G206301 NA non-coding upstream 74028 2003684 ~ 2003896 (+)
G206286 NA non-coding upstream 96140 1981550 ~ 1981784 (+)
G206252 NA non-coding upstream 106881 1965173 ~ 1971043 (+)
G206253 NA non-coding upstream 130481 1946350 ~ 1947443 (+)
G206326 NA non-coding downstream 1127 2079367 ~ 2079582 (+)
G206328 NA non-coding downstream 28216 2106456 ~ 2106682 (+)
G206345 NA non-coding downstream 78268 2156508 ~ 2156777 (+)
G206350 NA non-coding downstream 105588 2183828 ~ 2184131 (+)
CI01000049_01840330_01843844 FGF8B other upstream 234096 1839815 ~ 1844077 (+)
G207888 NA other downstream 1545762 3624002 ~ 3624311 (+)
G208074 NA other downstream 1799156 3877396 ~ 3882211 (+)
CI01000049_04473766_04475768 GM10043, LSM6, SNRPF, BRAFLDRAFT_125735 other downstream 2395285 4473662 ~ 4476270 (+)
G209660 NA other downstream 4799893 6878133 ~ 6882030 (+)
CI01000049_07219171_07224229 NA other downstream 5140608 7218811 ~ 7224268 (+)

Expression


Co-expression Network