G207286


Basic Information

Item Value
gene id G207286
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000049
NCBI id null
chromosome length 9665442
location 2101278 ~ 2101705 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU235228
TTTAGGCCAAGCAAACCTCCCATAATGCAATTGATTGATGTCTCCCCTTTGTAAAAGCACCCGGAAAATCAGAATGATTGAACTTGTCTATTTTGACATAGGCCTAGATCTTTTTCGGTTTAAGGAGCCCCATGCTTCAATCGCTTTTAAGGCTCCCCTGGGTACCACCATCTGCTCTTTTAGCTATATCTTTAAAAGTCAGCATCTGTTCACATAAAAGTGATGCAGTTTGGTAGATATGCTGTAAGAAGTGGTCAAAATGTTTTCAAATTTGATTCAGGAAAATGCTAGTAAGAGTTATTTGATCATGTTAAGTAACACCCACTTGAAATATTTTTAAGAACCTGCACTATTTATTCAGGACTGTGGATAATCATGAAATCTTGAGGAAATTATGTATGATACTGTATCAAATGGTAAACATTAGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU235228 True 428 lncRNA 0.36 1 2101278 2101705

Neighbor

gene id symbol gene type direction distance location
CI01000049_01971492_01983341 NA coding downstream 117360 1971291 ~ 1984030 (-)
CI01000049_01956684_01959474 NT5C2B, NT5C2, NT5C2A coding downstream 141804 1956684 ~ 1959474 (-)
CI01000049_01853220_01857322 DPCD coding downstream 243956 1852177 ~ 1857322 (-)
CI01000049_01782181_01783289 LBX1B coding downstream 317223 1781736 ~ 1784055 (-)
CI01000049_01773383_01778313 CENPK coding downstream 322469 1772768 ~ 1778809 (-)
CI01000049_02107910_02122886 PNPLA4 coding upstream 6031 2107736 ~ 2124286 (-)
CI01000049_02331749_02338716 NA coding upstream 229591 2331296 ~ 2338723 (-)
CI01000049_02519296_02524006 NA coding upstream 417372 2519077 ~ 2524006 (-)
CI01000049_02876185_02882477 NA coding upstream 773723 2875428 ~ 2882856 (-)
CI01000049_03081339_03089363 NA coding upstream 979304 3081009 ~ 3089363 (-)
G207313 NA non-coding downstream 31014 2069997 ~ 2070264 (-)
G207296 NA non-coding downstream 81920 2019015 ~ 2019358 (-)
G207272 NA non-coding downstream 119665 1981412 ~ 1981613 (-)
G207208 NA non-coding downstream 199138 1901093 ~ 1902140 (-)
G207320 NA non-coding upstream 39703 2141408 ~ 2141610 (-)
G207326 NA non-coding upstream 54802 2156507 ~ 2156778 (-)
G207331 NA non-coding upstream 75437 2177142 ~ 2177413 (-)
G207332 NA non-coding upstream 78907 2180612 ~ 2180958 (-)
G207333 NA non-coding upstream 82145 2183850 ~ 2184147 (-)
G207278 NA other downstream 112511 1987011 ~ 1988767 (-)
G206938 NA other downstream 1273633 825859 ~ 827645 (-)
G206850 NA other downstream 1468083 632680 ~ 633195 (-)
G206849 NA other downstream 1469702 631143 ~ 631576 (-)
G209491 NA other upstream 3926384 6028089 ~ 6028469 (-)
CI01000049_08056071_08059039 TIMM10.S, TIMM10, TIMM10.L other upstream 5953928 8055633 ~ 8059179 (-)
CI01000049_08452153_08453389 CISD2 other upstream 6349437 8451142 ~ 8454233 (-)
G211175 NA other upstream 6363588 8465293 ~ 8476265 (-)

Expression


Co-expression Network