G207655



Basic Information


Item Value
gene id G207655
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000049
NCBI id null
chromosome length 9665442
location 3046605 ~ 3046831 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU235635
TGACAGGACTCTTTGACAACCTAAAGCCATTTAAATGCACTGATCACTGTGGTTTCCTGCTTTTACAAGGTGTCGCCCTATAGAGTTTTGTCTCTAAATGAAGGTTTTTAGGGTGGTTTGACCTGTTTACTCCAGTAAGTGAAGGGTTAAATGAGCGGCATGTAGGTGAACGAGGGTGTAATGGTAGGTTTGTAGGCTTTTTTTCTTTATTATGAAGTAGACTCCAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU235635 True 227 lncRNA 0.41 1 3046605 3046831

Neighbor


gene id symbol gene type direction distance location
CI01000049_02876185_02882477 NA coding downstream 163749 2875428 ~ 2882856 (-)
CI01000049_02519296_02524006 NA coding downstream 522599 2519077 ~ 2524006 (-)
CI01000049_02331749_02338716 NA coding downstream 707882 2331296 ~ 2338723 (-)
CI01000049_02107910_02122886 PNPLA4 coding downstream 922319 2107736 ~ 2124286 (-)
CI01000049_01971492_01983341 NA coding downstream 1062687 1971291 ~ 1984030 (-)
CI01000049_03081339_03089363 NA coding upstream 34178 3081009 ~ 3089363 (-)
CI01000049_03093994_03098141 NA coding upstream 47006 3093837 ~ 3098141 (-)
CI01000049_03204366_03212170 CREB1, CREB1B, CREB1A coding upstream 157060 3203891 ~ 3212506 (-)
CI01000049_03256991_03257622 CLDNG coding upstream 210024 3256855 ~ 3257622 (-)
CI01000049_03667851_03702669 NA coding upstream 621020 3667851 ~ 3702669 (-)
G207590 NA non-coding downstream 294806 2751471 ~ 2751799 (-)
G207548 NA non-coding downstream 386893 2655915 ~ 2659712 (-)
G207504 NA non-coding downstream 536074 2510053 ~ 2510531 (-)
G207499 NA non-coding downstream 550674 2495731 ~ 2495931 (-)
G207493 NA non-coding downstream 559613 2486785 ~ 2486992 (-)
G207577 NA non-coding upstream 67328 3114159 ~ 3114981 (-)
G207669 NA non-coding upstream 158811 3205642 ~ 3223982 (-)
G207740 NA non-coding upstream 215504 3262335 ~ 3262612 (-)
G207742 NA non-coding upstream 219439 3266270 ~ 3266944 (-)
G207743 NA non-coding upstream 220783 3267614 ~ 3267866 (-)
G207278 NA other downstream 1057838 1987011 ~ 1988767 (-)
G206938 NA other downstream 2218960 825859 ~ 827645 (-)
G206850 NA other downstream 2413410 632680 ~ 633195 (-)
G206849 NA other downstream 2415029 631143 ~ 631576 (-)
G209491 NA other upstream 2981258 6028089 ~ 6028469 (-)
CI01000049_08056071_08059039 TIMM10.S, TIMM10, TIMM10.L other upstream 5008802 8055633 ~ 8059179 (-)
CI01000049_08452153_08453389 CISD2 other upstream 5404311 8451142 ~ 8454233 (-)
G211175 NA other upstream 5418462 8465293 ~ 8476265 (-)

Expression



Co-expression Network