G207974


Basic Information

Item Value
gene id G207974
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000049
NCBI id null
chromosome length 9665442
location 3613760 ~ 3613989 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU235980
GGAATTGACCCTGTCTCATTTCTCTGCCATGTACTGCTGGGACTGTGTCGCGCTGTATGTCTCACACACTGCAATTATTGGCTTGGCTAAAGGGGATGAGATAAAGGCCCACTCATCTAATCTAGAACCACTGAGACCTACAGAGAGAAATAGAGCCGGTGGTGTGTGCGCGCACGTGCCTTCATATTTGTCTGTCTAACTTGCTGTCTCGTTCTGTCTTTCTACATTAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU235980 True 230 lncRNA 0.48 1 3613760 3613989

Neighbor

gene id symbol gene type direction distance location
CI01000049_03256991_03257622 CLDNG coding downstream 356138 3256855 ~ 3257622 (-)
CI01000049_03204366_03212170 CREB1, CREB1B, CREB1A coding downstream 401254 3203891 ~ 3212506 (-)
CI01000049_03093994_03098141 NA coding downstream 515619 3093837 ~ 3098141 (-)
CI01000049_03081339_03089363 NA coding downstream 524397 3081009 ~ 3089363 (-)
CI01000049_02876185_02882477 NA coding downstream 730904 2875428 ~ 2882856 (-)
CI01000049_03667851_03702669 NA coding upstream 53862 3667851 ~ 3702669 (-)
CI01000049_03749311_03749697 NA coding upstream 134100 3748089 ~ 3752045 (-)
CI01000049_03782311_03782489 KLF5 coding upstream 167422 3781411 ~ 3782489 (-)
CI01000049_03790418_03842410 PIBF1 coding upstream 175997 3789986 ~ 3842605 (-)
CI01000049_03864331_03867898 TPT1 coding upstream 250020 3864009 ~ 3867967 (-)
G207969 NA non-coding downstream 4563 3608848 ~ 3609197 (-)
G207946 NA non-coding downstream 36280 3577242 ~ 3577480 (-)
G207945 NA non-coding downstream 36588 3576949 ~ 3577172 (-)
G207917 NA non-coding downstream 37235 3575016 ~ 3576525 (-)
G207676 NA non-coding downstream 227172 3375231 ~ 3386588 (-)
G207980 NA non-coding upstream 17070 3631059 ~ 3632808 (-)
G207990 NA non-coding upstream 27152 3641141 ~ 3641551 (-)
G208246 NA non-coding upstream 28010 3641999 ~ 3676804 (-)
G208287 NA non-coding upstream 142914 3756903 ~ 3760056 (-)
CI01000049_03901904_03904746 NA non-coding upstream 285614 3899710 ~ 3905482 (-)
G207278 NA other downstream 1624993 1987011 ~ 1988767 (-)
G206938 NA other downstream 2786115 825859 ~ 827645 (-)
G206850 NA other downstream 2980565 632680 ~ 633195 (-)
G206849 NA other downstream 2982184 631143 ~ 631576 (-)
G209491 NA other upstream 2414100 6028089 ~ 6028469 (-)
CI01000049_08056071_08059039 TIMM10.S, TIMM10, TIMM10.L other upstream 4441644 8055633 ~ 8059179 (-)
CI01000049_08452153_08453389 CISD2 other upstream 4837153 8451142 ~ 8454233 (-)
G211175 NA other upstream 4851304 8465293 ~ 8476265 (-)

Expression


Co-expression Network