G208019


Basic Information

Item Value
gene id G208019
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000049
NCBI id null
chromosome length 9665442
location 3710751 ~ 3711934 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU236043
GTGCCTCCTGGAATGCAAGATCACAGCTGACTGTAGACTGCTGACGCCACTCCATCACCGCTCCAAATCACACCTACAAACCCCTGTTTTATGCTTTCTGATTTCCCGTAACTATTATTAAATTTCACTTCCCAGATGTGTAGACTCGAAAGCGCAAGGTGTTTCCCGTTACCAGCGCTCGTGCCTCCAACACAACTCTTTTAATCTGTTGCAAACACTCCTCTTCAAATTCACACCTTGAACGCCCAGCAGCTCTCCTGAGTCAAACCACCGAACTTGCTTGTTGTCGTAAGCAGGAACAGAAGTGTCCCAGTTCAGTGATGAGAGAGGGGGGTAAGTGCACAAGACATCTGCGTGTTTGCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU236043 True 363 lncRNA 0.48 2 3710751 3711934

Neighbor

gene id symbol gene type direction distance location
CI01000049_03631096_03632219 KCTD12.2 coding upstream 78381 3629377 ~ 3632370 (+)
CI01000049_03593799_03605097 SLC5A7 coding upstream 104260 3593727 ~ 3606491 (+)
CI01000049_03584412_03585910 ARL6 coding upstream 124652 3582032 ~ 3586099 (+)
CI01000049_03475307_03572415 EPHA6 coding upstream 138336 3475307 ~ 3572415 (+)
CI01000049_03292042_03304890 NA coding upstream 405650 3292042 ~ 3305101 (+)
CI01000049_03756695_03758838 KLF12 coding downstream 44489 3756423 ~ 3759295 (+)
CI01000049_03843068_03843461 NA coding downstream 130918 3842852 ~ 3843545 (+)
CI01000049_03844455_03850424 GPALPP1 coding downstream 132521 3844455 ~ 3850430 (+)
CI01000049_03852103_03860363 GTF2F2A coding downstream 140169 3852103 ~ 3860774 (+)
CI01000049_03872066_03885573 NA coding downstream 160132 3872066 ~ 3886240 (+)
G207989 NA non-coding upstream 69198 3641252 ~ 3641553 (+)
G207889 NA non-coding upstream 82577 3627949 ~ 3628174 (+)
G207876 NA non-coding upstream 118914 3591457 ~ 3591837 (+)
G206829 NA non-coding upstream 339413 3371097 ~ 3371338 (+)
G206828 NA non-coding upstream 341354 3369113 ~ 3369397 (+)
G208071 NA non-coding downstream 187775 3899709 ~ 3901473 (+)
G208090 NA non-coding downstream 210492 3922426 ~ 3922879 (+)
G208095 NA non-coding downstream 220430 3932364 ~ 3932589 (+)
G208096 NA non-coding downstream 221338 3933272 ~ 3933626 (+)
G208098 NA non-coding downstream 228126 3940060 ~ 3940304 (+)
G207888 NA other upstream 86440 3624002 ~ 3624311 (+)
CI01000049_01840330_01843844 FGF8B other upstream 1866923 1839815 ~ 1844077 (+)
G208074 NA other downstream 165462 3877396 ~ 3882211 (+)
CI01000049_04473766_04475768 GM10043, LSM6, SNRPF, BRAFLDRAFT_125735 other downstream 761591 4473662 ~ 4476270 (+)
G209660 NA other downstream 3166199 6878133 ~ 6882030 (+)
CI01000049_07219171_07224229 NA other downstream 3506914 7218811 ~ 7224268 (+)
G210091 NA other downstream 4161816 7873750 ~ 7878856 (+)

Expression


Co-expression Network