G208467


Basic Information

Item Value
gene id G208467
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000049
NCBI id null
chromosome length 9665442
location 4329592 ~ 4329819 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU236529
CTTTTCTGGGCCTAAGGACCACTTTACTGTCATTAGGACCTAAATCAAGGCAGGAAGGTTCCACAGATAGAGCCTGCAATTCTCCAACTCGCTTGACTGACGCTAAAGCCAGCAAGAGGGCAGTCTTAAGTGAAAGGGACCGAAGGTCAGCTGACTCAAGCAGTTCAAAGGGAGGGCCCCGAAGTTCTCTAAGGACTGTGGAGAGGTCCCACGATGGGACCGAGAAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU236529 True 228 lncRNA 0.52 1 4329592 4329819

Neighbor

gene id symbol gene type direction distance location
CI01000049_04296486_04310931 SMAD1.L, SMAD1, SMAD1.S coding downstream 16485 4295126 ~ 4313107 (-)
CI01000049_04144005_04150776 NA coding downstream 178816 4143984 ~ 4150776 (-)
CI01000049_04126260_04127962 NA coding downstream 199141 4125683 ~ 4130451 (-)
CI01000049_04094686_04123864 FREM3 coding downstream 205296 4094124 ~ 4124296 (-)
CI01000049_03993313_03994107 NA coding downstream 335485 3992645 ~ 3994107 (-)
CI01000049_04341160_04342702 NA coding upstream 11239 4341058 ~ 4342702 (-)
CI01000049_04380746_04381576 NA coding upstream 49033 4378852 ~ 4382808 (-)
CI01000049_04386375_04434840 ZNF827 coding upstream 56556 4386375 ~ 4434840 (-)
CI01000049_04453790_04454764 NA coding upstream 123601 4453420 ~ 4456017 (-)
CI01000049_04644316_04648048 NA coding upstream 314481 4644300 ~ 4648729 (-)
G208436 NA non-coding downstream 1751 4323822 ~ 4327841 (-)
G208462 NA non-coding downstream 7237 4322145 ~ 4322355 (-)
G208461 NA non-coding downstream 10159 4319212 ~ 4319433 (-)
G208459 NA non-coding downstream 36497 4292867 ~ 4293095 (-)
G208414 NA non-coding downstream 69684 4229871 ~ 4259908 (-)
G208438 NA non-coding upstream 77062 4406881 ~ 4415032 (-)
G208488 NA non-coding upstream 146605 4476424 ~ 4476772 (-)
G208494 NA non-coding upstream 158277 4488096 ~ 4488355 (-)
G208495 NA non-coding upstream 158763 4488582 ~ 4488787 (-)
G208510 NA non-coding upstream 175980 4505799 ~ 4506028 (-)
G207278 NA other downstream 2340825 1987011 ~ 1988767 (-)
G206938 NA other downstream 3501947 825859 ~ 827645 (-)
G206850 NA other downstream 3696397 632680 ~ 633195 (-)
G206849 NA other downstream 3698016 631143 ~ 631576 (-)
G209491 NA other upstream 1698270 6028089 ~ 6028469 (-)
CI01000049_08056071_08059039 TIMM10.S, TIMM10, TIMM10.L other upstream 3725814 8055633 ~ 8059179 (-)
CI01000049_08452153_08453389 CISD2 other upstream 4121323 8451142 ~ 8454233 (-)
G211175 NA other upstream 4135474 8465293 ~ 8476265 (-)

Expression


Co-expression Network