G216921


Basic Information

Item Value
gene id G216921
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 7140815 ~ 7141101 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU246067
CACAGGTGGCATGATGAGATAAAGCACATAACCGACTCATCCATCCACAGCCACCAGTATAGATCGCGCAGTCGTTGCTTAGTGCGCACAATGCCCTGGTGTCCCTCATGCGCGAGCATCATTAACCTGTGGCGTAATGACACAGGTGCAATGAGACGTGATCTCCTAAGGATGAAGTCGTCCGTTGCAGCAAGTCACTTAAAACACATATTTATTTATATTTCAAATTTGCACATATCATAGCTGTACATACAAAATTGTCTATATTATATATTGTGTTTTTTTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU246067 True 287 lncRNA 0.42 1 7140815 7141101

Neighbor

gene id symbol gene type direction distance location
CI01000050_07047887_07057166 TAS1R2.2 coding downstream 83401 7047552 ~ 7057414 (-)
CI01000050_07037053_07037750 HER3 coding downstream 103001 7036592 ~ 7037814 (-)
CI01000050_07030874_07033872 NA coding downstream 106943 7030635 ~ 7033872 (-)
CI01000050_06949824_06962679 NA coding downstream 177169 6949347 ~ 6963646 (-)
CI01000050_06752838_06802179 ESPN coding downstream 338332 6752781 ~ 6802483 (-)
CI01000050_07155856_07157697 NA coding upstream 13970 7154965 ~ 7157697 (-)
CI01000050_07207399_07217984 OGG1 coding upstream 66074 7207175 ~ 7217984 (-)
CI01000050_07239689_07244721 NA coding upstream 98514 7239615 ~ 7244721 (-)
CI01000050_07307744_07309403 NA coding upstream 166310 7307411 ~ 7310537 (-)
CI01000050_07338022_07340567 ANGPTL7 coding upstream 196344 7337445 ~ 7341011 (-)
G216918 NA non-coding downstream 3140 7136521 ~ 7137675 (-)
G216768 NA non-coding downstream 16468 7123865 ~ 7124347 (-)
G216795 NA non-coding downstream 42750 7097751 ~ 7098065 (-)
G216790 NA non-coding downstream 60099 7080473 ~ 7080716 (-)
G216788 NA non-coding downstream 62494 7078086 ~ 7078321 (-)
G216922 NA non-coding upstream 239 7141340 ~ 7141657 (-)
G216924 NA non-coding upstream 2669 7143770 ~ 7144204 (-)
G216925 NA non-coding upstream 4219 7145320 ~ 7145596 (-)
G216927 NA non-coding upstream 8420 7149521 ~ 7149905 (-)
G216408 NA other downstream 784304 6356017 ~ 6356511 (-)
G216093 NA other downstream 1588712 5489557 ~ 5552103 (-)
G215935 NA other downstream 2067706 5048916 ~ 5073109 (-)
CI01000050_04564233_04580815 KANSL3 other downstream 2527923 4563687 ~ 4581278 (-)
G214436 NA other downstream 3551758 3525816 ~ 3589057 (-)
G216931 NA other upstream 22994 7164095 ~ 7165401 (-)

Expression


Co-expression Network