CI01000051_00262483_00263385 (BLK)


Basic Information

Item Value
gene id CI01000051_00262483_00263385
gene name BLK
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 262441 ~ 263385 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000051_00262483_00263385.mRNA
ATTGCGGAGGGCATGGCTTACATAGAGAGGAAAAACTACATTCACAGAGATCTGCGTGCCGCTAATATTCTCGTCTCGGAGACCCTGCACTGTAAAATAGCAGACTTCGGCCTCGCCAGGATCATCGAATCTGAATACACTGCACAGGAAGGTGCAAAGTTCCCTATTAAGTGGACGGCCCCTGAGGCCATCAACTTTGGTACTTTCACCATCAAGTCAGACGTCTGGTCCTTTGGAGTTCTTCTGACAGAGATTGTCACATATGGCAGAGTACCGTATCCAGGCATGACGAATCCGGAGGTGATCCGTAACCTCGACAGGAGCTACAGAATGCCGTGTCCGGATGGATGTCCAGGAGAGCTCTATGACATCATGCTGAAGTGCTGGAAGGAAAGGCCCGAGGACAGACCCACCTTTGAGCACCTACAGGACACACTCAATGACTTTTTCATTGCTACTGAGGGCCAGTACGAGATGCAACCATAGCCTCCATTCAGAAACTGTATGAATGAATAGATGAACTATAAA

Function

symbol description
blk Predicted to enable non-membrane spanning protein tyrosine kinase activity and signaling receptor binding activity. Predicted to be involved in several processes, including immune system development; negative regulation of leukocyte proliferation; and regulation of leukocyte apoptotic process. Predicted to act upstream of or within protein phosphorylation. Predicted to be extrinsic component of cytoplasmic side of plasma membrane. Human ortholog(s) of this gene implicated in maturity-onset diabetes of the young type 11 and systemic lupus erythematosus. Orthologous to human BLK (BLK proto-oncogene, Src family tyrosine kinase).

GO:

id name namespace
GO:0042127 regulation of cell population proliferation biological_process

KEGG:

id description
K08890 BLK; B lymphoid tyrosine kinase

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000051_00262483_00263385.mRNA True 528 mRNA 0.49 3 262441 263385

Neighbor

gene id symbol gene type direction distance location
CI01000051_00224709_00227613 NA coding downstream 34828 224507 ~ 227613 (-)
CI01000051_00131867_00138611 ZNF513 coding downstream 123651 130386 ~ 138790 (-)
CI01000051_00083434_00086769 NA coding downstream 175082 82720 ~ 87359 (-)
CI01000051_00036318_00057051 SCARA5 coding downstream 205390 36318 ~ 57051 (-)
CI01000051_00000977_00002147 NA coding downstream 259902 810 ~ 2539 (-)
CI01000051_00278614_00302552 NA coding upstream 14807 278192 ~ 304373 (-)
CI01000051_00334616_00337009 SOX7 coding upstream 70668 334053 ~ 337197 (-)
CI01000051_00346827_00352024 NA coding upstream 83442 346827 ~ 352381 (-)
CI01000051_00357855_00378052 NA coding upstream 93449 356834 ~ 378052 (-)
CI01000051_00383638_00388102 TDH, TDH.S coding upstream 119937 383322 ~ 388102 (-)
G217417 NA non-coding downstream 44286 216869 ~ 218155 (-)
G217420 NA non-coding downstream 45674 215484 ~ 216767 (-)
G217419 NA non-coding downstream 47317 214080 ~ 215124 (-)
G217424 NA non-coding downstream 48589 213614 ~ 213852 (-)
G217423 NA non-coding downstream 49071 211892 ~ 213370 (-)
G217553 NA non-coding upstream 34665 298050 ~ 298268 (-)
CI01000051_00394082_00407612 MTMR9 non-coding upstream 129335 392720 ~ 407612 (-)
G217532 NA non-coding upstream 133633 397018 ~ 397424 (-)
G217531 NA non-coding upstream 150461 413846 ~ 414972 (-)
G217573 NA non-coding upstream 164639 428024 ~ 428243 (-)
CI01000051_00560810_00563417 NA other upstream 298811 560768 ~ 563417 (-)
CI01000051_01785489_01787612 IGFBP1A other upstream 1445913 1784416 ~ 1787760 (-)
G218728 NA other upstream 2263958 2527343 ~ 2546459 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location