Fish Transcriptome and Expression Database

Home /
Search /
- Gene
- RNA
- Bioproject
Expression /
Analysis /
- Coding ability prediction
- Expression count
- Visual Omics
Tools /
- Neighbor
- BLAST
Statistics /
Download /
Help

model fish

XLOC_009675

Basic Information

Item	Value
gene id	XLOC_009675
gene name	NA
gene type	non-coding
species	zebrafish (Danio rerio)
category of species	model fish

Chromosome Information

Item	Value
chromosome id	NC_007127.7
NCBI id	CM002900.2
chromosome length	55266484
location	7118147 ~ 7118568 (+)
genome version	GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00021883
AATATCCTAATTTACCAAGTTCACAGTTTTTCCCATAAATTCCCATTAAATCATTTTATAGTTAGTTTCCTTGGAAAGTTTTAAGCCTTGAAAAATCCCGAAATTTTGCAACCCTACCACATGATATGATTTTATTAGCATGCTTGTGTCACGATACAATATTATTGTGTTTATTGCTCTGCAAATTTCTTTAATGCCGCCATCTTTATTTTACTAACATCTGTATAATAAAG

Function

GO: NA

KEGG:

id	description
ko03230	Viral genome structure
ko05164	Influenza A
ko03200	Viral proteins

RNA

RNA id	representative	length	rna type	GC content	exon number	start site	end site
TCONS_00021883	True	233	lncRNA	0.30	2	7118147	7118568

Notice the +/- strand.
Display format: symbol/gene id: RNA id. (Except when gene id is similar to RNA id.)
You can browse transcripts by dragging.
A more detailed transcript can be viewed by the zoom button in the upper right corner.

Neighbor

gene id	symbol	gene type	direction	distance	location
XLOC_009674	bbs9	coding	upstream	55198	6957582 ~ 7062949 (+)
XLOC_009673	eaf1	coding	upstream	162602	6944311 ~ 6955545 (+)
XLOC_009672	arhgef2	coding	upstream	184969	6864244 ~ 6933178 (+)
XLOC_009671	znf236	coding	upstream	317515	6750289 ~ 6800632 (+)
XLOC_009670	znf407	coding	upstream	370873	6727195 ~ 6747274 (+)
XLOC_009676	bmper	coding	downstream	35698	7154266 ~ 7195000 (+)
XLOC_009677	NA	coding	downstream	108108	7226676 ~ 7232180 (+)
XLOC_009678	CU466278.2	coding	downstream	109016	7227584 ~ 7294953 (+)
XLOC_009679	sri	coding	downstream	124042	7242610 ~ 7260345 (+)
XLOC_009680	atg5	coding	downstream	261895	7380463 ~ 7416532 (+)
XLOC_009668	NA	non-coding	upstream	696698	6395303 ~ 6421449 (+)
XLOC_009659	NA	non-coding	upstream	1615448	5499274 ~ 5502699 (+)
XLOC_009654	FO722028.1	non-coding	upstream	2243666	4874364 ~ 4874481 (+)
XLOC_009650	NA	non-coding	upstream	2406419	4708735 ~ 4711728 (+)
XLOC_009647	NA	non-coding	upstream	2558235	4559111 ~ 4559912 (+)
XLOC_009681	NA	non-coding	downstream	396282	7514850 ~ 7515507 (+)
XLOC_009682	CT574585.2	non-coding	downstream	445959	7564527 ~ 7566095 (+)
XLOC_009688	NA	non-coding	downstream	674153	7792721 ~ 7793768 (+)

Expression

Co-expression Network