CI01000051_05579061_05584087 (CRIP2)


Basic Information

Item Value
gene id CI01000051_05579061_05584087
gene name CRIP2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 5579061 ~ 5584087 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000051_05579061_05584087.mRNA
CGGAGAAAGTGACATCTCTGGGGAAAGACTGGCACAAATTCTGTCTGAAATGTGAACGCTGTAACAAGACCCTGAATCCAGGAGGACATGCAGAGCATGATGGGAAGCCATACTGCCACAAGCCATGCTATGCTGCCCTCTATGGACCAAAAGGTGTGAATATTGGTGGGGCAGGATCATATGTCTATGACACACCTGCCAACGATGATACTGCCCCTGTTGCCATGGAAACCAAACCCAAGACTGAAGAGAAAAAGGCTACCAGGGGTCCAGTGAAGGCTGCAAGTTTCAGTTCGTTCTCTGGTGAGCCAAACATCTGCCCAAGGTGCAACAAAACAGTGTACTTTGCTGAAAAGGTCAGTTCCCTGGGTAAAGACTGGCACAGACCCTGTCTGCGCTGTGAGAGGTGCAGTAAGACTCTGGCTCCAGGCAGCCATGCAGAG

Function

symbol description
crip2 Predicted to enable metal ion binding activity. Acts upstream of or within heart contraction and heart development. Is expressed in several structures, including cardiovascular system; mesoderm; nervous system; neural crest; and notochord. Orthologous to human CRIP2 (cysteine rich protein 2).

GO:

id name namespace
GO:0008284 positive regulation of cell population proliferation biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000051_05579061_05584087.mRNA True 443 mRNA 0.51 5 5579061 5584087

Neighbor

gene id symbol gene type direction distance location
CI01000051_05523573_05525861 NA coding upstream 52054 5523362 ~ 5527007 (+)
CI01000051_05514127_05516929 ZFP36L1B, ZFP36L1 coding upstream 61276 5512756 ~ 5517785 (+)
CI01000051_05454570_05480649 NA coding upstream 98126 5454532 ~ 5480935 (+)
CI01000051_05401881_05405868 NA coding upstream 173175 5401881 ~ 5405886 (+)
CI01000051_05320361_05322570 GJD2B, GJD2 coding upstream 255156 5320361 ~ 5323905 (+)
CI01000051_05588671_05593438 RDH14B coding downstream 4205 5588292 ~ 5593977 (+)
CI01000051_05657394_05672861 SYT14B, SYT14 coding downstream 73307 5657394 ~ 5674202 (+)
CI01000051_05712567_05728993 YLPM1 coding downstream 128480 5712567 ~ 5729691 (+)
CI01000051_05757566_05757955 C12ORF57 coding downstream 173479 5757566 ~ 5758141 (+)
CI01000051_05831209_05933202 DLGAP2 coding downstream 247122 5831209 ~ 5933637 (+)
G220889 NA non-coding upstream 7324 5571458 ~ 5571737 (+)
G220861 NA non-coding upstream 56275 5521857 ~ 5522786 (+)
G220856 NA non-coding upstream 80402 5498104 ~ 5498659 (+)
G220850 NA non-coding upstream 88774 5490068 ~ 5490287 (+)
G220846 NA non-coding upstream 93340 5485478 ~ 5485721 (+)
G220922 NA non-coding downstream 92377 5676464 ~ 5676963 (+)
G220930 NA non-coding downstream 155492 5739579 ~ 5740171 (+)
G220916 NA non-coding downstream 156971 5741058 ~ 5744465 (+)
G220923 NA non-coding downstream 205441 5789528 ~ 5830106 (+)
G220920 NA non-coding downstream 361503 5945590 ~ 5946344 (+)
G219803 NA other upstream 527028 4914974 ~ 5052033 (+)
CI01000051_04374052_04393328 NA other upstream 1203731 4372658 ~ 4393677 (+)
G218981 NA other upstream 2332188 3245443 ~ 3246873 (+)
CI01000051_02060996_02061735 NA other upstream 3512978 2060534 ~ 2062355 (+)
CI01000051_00638200_00720543 CDC42BPB other upstream 4854357 637590 ~ 720669 (+)
CI01000051_06825895_06830637 NA other downstream 1241712 6825895 ~ 6830637 (+)
G221319 NA other downstream 1757954 7342041 ~ 7342546 (+)
G221386 NA other downstream 1825436 7401175 ~ 7413007 (+)
CI01000051_08211233_08214513 NA other downstream 2521556 8209722 ~ 8214696 (+)
G222727 NA other downstream 2758855 8342942 ~ 8343448 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_017920 crip2l coding NC_007131.7 CM002904.2 9428965 ~ 9462449 (-)