XLOC_009682 (CT574585.2)


Basic Information

Item Value
gene id XLOC_009682
gene name CT574585.2
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 7564527 ~ 7566095 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00019412
ttgtgaaaagggtgtaattgttaaaaataggtacaaacatcagatataaacaaaaacctaaacaaacacttctatgtacataacgtcataaaaatacttgttttatttacctcgcgctgccgtccttgtactgccgtgaacaggaaattctgggaatggaggacggagagttgaatcgattcgtcttcaacaaaccgatcagtgtgacatcaaaacatcgcgagaacaacagacagctccgtgtgcatttgaatccatctcgcgatattgtatcacttcaggtacgcgcctactgattcgttgattcaaacgagttgtgaatcaagaagcctctaaagatccgaatcaaactgcagcagcacgccacgaggttttgctcagacttttgggacgtttggaattgctccgtcttgtcaccatgtaacacatagcagcaagacccatgggatttcatcagccactcaccatcagagtcctcagtggaagctgagaagagcagaagaggaagccaagcaagagatgccagaaaaaaagggggaatgaaatattgtgttattttgctgtttgagtttaggcaggcgcagtgggtagcacaatcgcctcacagcaagaaggtcgctggttcgagcctcggctgggtcagttggcatttctgtgtggagtttgcatgttctccccatgttagcgtgggtttcctccgggtgctcccacaagtccaaaaatatgtggtgacattgggtaaggtaaaattgtccgtagtgtatgtgtgtgaatgagtatgtatggatgtttcccagtgatgggttgcagctgggtggcaacacggtggcacagtaggtagtgctgtttcctcacatcaagaaggt

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0065007 biological regulation biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0060896 neural plate pattern specification biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0060897 neural plate regionalization biological_process
GO:0001756 somitogenesis biological_process
GO:0043009 chordate embryonic development biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0006366 transcription by RNA polymerase II biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009058 biosynthetic process biological_process
GO:0009059 macromolecule biosynthetic process biological_process
GO:1901576 organic substance biosynthetic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0060429 epithelium development biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044249 cellular biosynthetic process biological_process
GO:0009952 anterior/posterior pattern specification biological_process
GO:0044271 cellular nitrogen compound biosynthetic process biological_process
GO:0007369 gastrulation biological_process
GO:0048646 anatomical structure formation involved in morphogenesis biological_process
GO:0040017 positive regulation of locomotion biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0003002 regionalization biological_process
GO:0007389 pattern specification process biological_process
GO:0050789 regulation of biological process biological_process
GO:0061053 somite development biological_process
GO:0050794 regulation of cellular process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0007417 central nervous system development biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034645 cellular macromolecule biosynthetic process biological_process
GO:0007420 brain development biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0060322 head development biological_process
GO:0009792 embryo development ending in birth or egg hatching biological_process
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000105505

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00019412 True 866 lncRNA 0.46 2 7564527 7566095

Neighbor

gene id symbol gene type direction distance location
XLOC_009681 NA coding upstream 49020 7514850 ~ 7515507 (+)
XLOC_009680 atg5 coding upstream 147995 7380463 ~ 7416532 (+)
XLOC_009678 CU466278.2 coding upstream 269574 7227584 ~ 7294953 (+)
XLOC_009679 sri coding upstream 304182 7242610 ~ 7260345 (+)
XLOC_009677 NA coding upstream 332347 7226676 ~ 7232180 (+)
XLOC_009683 stx12l coding downstream 60440 7626535 ~ 7641367 (+)
XLOC_009684 popdc3 coding downstream 87810 7653905 ~ 7658707 (+)
XLOC_009685 bves coding downstream 96514 7662609 ~ 7681144 (+)
XLOC_009686 ccr11.1 coding downstream 131918 7698013 ~ 7699207 (+)
XLOC_009687 cnot10 coding downstream 137439 7703534 ~ 7730836 (+)
XLOC_009675 NA non-coding upstream 445959 7118147 ~ 7118568 (+)
XLOC_009668 NA non-coding upstream 1143078 6395303 ~ 6421449 (+)
XLOC_009688 NA non-coding downstream 226626 7792721 ~ 7793768 (+)
XLOC_009691 NA non-coding downstream 789384 8355479 ~ 8372570 (+)
XLOC_009696 NA non-coding downstream 1398794 8964889 ~ 8965839 (+)
XLOC_009697 NA non-coding downstream 1400114 8966209 ~ 8966926 (+)
XLOC_009699 CR394537.2 non-coding downstream 1671037 9237132 ~ 9237246 (+)

Expression


Co-expression Network