G217430



Basic Information


Item Value
gene id G217430
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 128614 ~ 128880 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU246672
TAACCTGTGCTATTTTTTTTAGGATTCACTGATGAATGAAAAAGTTAAAAAGAACTGAATTTATTCAAAATAGAAATCTTTTCTAACAACATACACTGTCCGTTCCAAAGTTACTGAAAAAATTACTGGGGACAGCATATTTTTTTCCTTTTTTTTCTGAAAGAAATGAATACTTTTATTCAGCAAAGATGTGCTAAATTGATAAAAAAAAAATGATAGTAAAGATTTATATTGTTAGAAAAGATTTCTATTTTGAATAAATACTGT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU246672 True 267 lncRNA 0.25 1 128614 128880

Neighbor


gene id symbol gene type direction distance location
CI01000051_00083434_00086769 NA coding downstream 41255 82720 ~ 87359 (-)
CI01000051_00036318_00057051 SCARA5 coding downstream 71563 36318 ~ 57051 (-)
CI01000051_00000977_00002147 NA coding downstream 126075 810 ~ 2539 (-)
CI01000051_00131867_00138611 ZNF513 coding upstream 1692 130386 ~ 138790 (-)
CI01000051_00224709_00227613 NA coding upstream 95627 224507 ~ 227613 (-)
CI01000051_00262483_00263385 BLK coding upstream 133561 262441 ~ 263385 (-)
CI01000051_00278614_00302552 NA coding upstream 149312 278192 ~ 304373 (-)
CI01000051_00334616_00337009 SOX7 coding upstream 205173 334053 ~ 337197 (-)
G217410 NA non-coding downstream 30906 80788 ~ 97708 (-)
G217426 NA non-coding downstream 51327 73998 ~ 77287 (-)
G217453 NA non-coding downstream 57094 70343 ~ 71520 (-)
G217399 NA non-coding downstream 109252 18604 ~ 19362 (-)
G217411 NA non-coding upstream 232 129112 ~ 129592 (-)
G217468 NA non-coding upstream 12625 141505 ~ 141743 (-)
G217425 NA non-coding upstream 29077 157957 ~ 160923 (-)
G217473 NA non-coding upstream 38306 167186 ~ 167430 (-)
CI01000051_00394082_00407612 MTMR9 other upstream 266351 392720 ~ 407612 (-)
CI01000051_00560810_00563417 NA other upstream 433316 560768 ~ 563417 (-)
CI01000051_01785489_01787612 IGFBP1A other upstream 1580418 1784416 ~ 1787760 (-)

Expression



Co-expression Network