G217424


Basic Information

Item Value
gene id G217424
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 213614 ~ 213852 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU246666
CTCCACGCATTACGTAATCACGTGTGACGTAGGCGGAGTGTTTACAAAGCGAACCTGCAAAGACTAAGTCAAACGGACTACAAAAAAAAAGGTAAAACAACAATGTCGGACAATTTCGAAGTTGGAGGAGAAAATGAGATGGAGTTTTTTGCTCTACTACTTCCGCCTACGTCACGCGCGACCTTTTCAACGCGATTACGTAATGCGTGGAGCATCACAGAGCAGTGCAAGACGAGCAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU246666 True 239 lncRNA 0.46 1 213614 213852

Neighbor

gene id symbol gene type direction distance location
CI01000051_00131867_00138611 ZNF513 coding downstream 74824 130386 ~ 138790 (-)
CI01000051_00083434_00086769 NA coding downstream 126255 82720 ~ 87359 (-)
CI01000051_00036318_00057051 SCARA5 coding downstream 156563 36318 ~ 57051 (-)
CI01000051_00000977_00002147 NA coding downstream 211075 810 ~ 2539 (-)
CI01000051_00224709_00227613 NA coding upstream 10655 224507 ~ 227613 (-)
CI01000051_00262483_00263385 BLK coding upstream 48589 262441 ~ 263385 (-)
CI01000051_00278614_00302552 NA coding upstream 64340 278192 ~ 304373 (-)
CI01000051_00334616_00337009 SOX7 coding upstream 120201 334053 ~ 337197 (-)
CI01000051_00346827_00352024 NA coding upstream 132975 346827 ~ 352381 (-)
G217423 NA non-coding downstream 244 211892 ~ 213370 (-)
G217489 NA non-coding downstream 6320 206849 ~ 207294 (-)
G217488 NA non-coding downstream 9551 203436 ~ 204063 (-)
G217487 NA non-coding downstream 10219 203180 ~ 203395 (-)
G217486 NA non-coding downstream 10632 202778 ~ 202982 (-)
G217419 NA non-coding upstream 228 214080 ~ 215124 (-)
G217420 NA non-coding upstream 1632 215484 ~ 216767 (-)
G217417 NA non-coding upstream 3017 216869 ~ 218155 (-)
G217553 NA non-coding upstream 84198 298050 ~ 298268 (-)
CI01000051_00394082_00407612 MTMR9 non-coding upstream 178868 392720 ~ 407612 (-)
CI01000051_00560810_00563417 NA other upstream 348344 560768 ~ 563417 (-)
CI01000051_01785489_01787612 IGFBP1A other upstream 1495446 1784416 ~ 1787760 (-)

Expression


Co-expression Network