G217151


Basic Information

Item Value
gene id G217151
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 288843 ~ 289109 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU246349
TTGCATCAGGCTCTTCTGCTTGTATTTCCGCAACTTTTGATGCTTTGGATTTTGCAGAGATACTGGTTTTGGTAGAAATATCAGATCTTCCCGACATAGCACTTGGCACTCTGTCCCCTTTTTCCTCGTTATCAGTATTGACATCTGTTGCAGAAGCATTTGACTTTTTTGATTTTGCAGAAACATTTGACTTGGCAGACAAAGCACTTGAAGCTCTCTCTTCTTCTTGGTCTTTTGCATCAACAAGCTCATCAGTTAAAACATCTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU246349 True 267 lncRNA 0.40 1 288843 289109

Neighbor

gene id symbol gene type direction distance location
CI01000051_00194573_00205676 NA coding upstream 83108 193827 ~ 205735 (+)
CI01000051_00147585_00164301 NA coding upstream 123794 147585 ~ 165049 (+)
CI01000051_00094391_00124007 SNX17 coding upstream 164683 94391 ~ 124160 (+)
CI01000051_00074000_00080983 EIF2B4 coding upstream 207781 74000 ~ 81062 (+)
CI01000051_00017447_00029701 TAB2 coding upstream 259042 17447 ~ 29801 (+)
CI01000051_00414617_00476423 XKR6B, XKR6 coding downstream 125508 414617 ~ 476423 (+)
CI01000051_00487642_00497395 CCM2 coding downstream 198533 487642 ~ 498310 (+)
CI01000051_00514656_00517593 ENPP5 coding downstream 224706 513815 ~ 518014 (+)
CI01000051_00638200_00720543 CDC42BPB coding downstream 349091 637590 ~ 720669 (+)
CI01000051_00729622_00743172 NA coding downstream 440513 729622 ~ 743240 (+)
G217146 NA non-coding upstream 9263 279218 ~ 279580 (+)
G217144 NA non-coding upstream 19643 268832 ~ 269200 (+)
G217088 NA non-coding upstream 73663 214076 ~ 215180 (+)
G217095 NA non-coding upstream 74981 213616 ~ 213862 (+)
G217091 NA non-coding upstream 75446 211872 ~ 213397 (+)
G217153 NA non-coding downstream 2853 291962 ~ 292248 (+)
G217075 NA non-coding downstream 67770 324465 ~ 384128 (+)
G217086 NA non-coding downstream 103527 392636 ~ 394298 (+)
G217092 NA non-coding downstream 115579 404688 ~ 405457 (+)
G217189 NA non-coding downstream 164526 453635 ~ 454168 (+)
CI01000051_02060996_02061735 NA other downstream 1770878 2060534 ~ 2062355 (+)
G218981 NA other downstream 2956334 3245443 ~ 3246873 (+)
CI01000051_04374052_04393328 NA other downstream 4085301 4372658 ~ 4393677 (+)

Expression


Co-expression Network