G217783


Basic Information

Item Value
gene id G217783
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 1150241 ~ 1150465 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU247054
CAGGAACACATCAAGCCGATGGTCGGCCGTCAGGCAGTTTTTGTTCGTCGGCCGACTAAGTTTTCTCAGTGTGTTCCGCACCATCAGCTGAAGTTGGTCCTCGTTGGCTTTTTTTCGGCCGATTCGACATGTTGAACCAGCGTCAGAGCTCGTTGGTCCGTCAGGCCATCTGATCATTCCGATTGGCTGTTCAGCTACTGCCACCTGCTGGTACGGAAAGACATT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU247054 True 225 lncRNA 0.53 1 1150241 1150465

Neighbor

gene id symbol gene type direction distance location
CI01000051_01015039_01066156 CDH2 coding downstream 83924 1014806 ~ 1066317 (-)
CI01000051_00846746_00856041 AQP4 coding downstream 294200 846502 ~ 856041 (-)
CI01000051_00824615_00825825 KCTD1 coding downstream 324165 824615 ~ 826076 (-)
CI01000051_00809947_00817933 KCTD1 coding downstream 332308 809947 ~ 817933 (-)
CI01000051_00787723_00808318 NA coding downstream 341217 787723 ~ 809024 (-)
CI01000051_01371462_01386606 NA coding upstream 220997 1371462 ~ 1386606 (-)
CI01000051_01468663_01486168 B4GALT5, B4GALT6 coding upstream 317954 1468419 ~ 1487172 (-)
CI01000051_01511542_01512516 NA coding upstream 360678 1511143 ~ 1512554 (-)
CI01000051_01528013_01535266 OPN7A coding upstream 377444 1527909 ~ 1535266 (-)
CI01000051_01560871_01627451 TRAPPC8 coding upstream 410363 1560828 ~ 1627665 (-)
G217779 NA non-coding downstream 11456 1138482 ~ 1138785 (-)
G217731 NA non-coding downstream 175711 943514 ~ 974530 (-)
G217698 NA non-coding downstream 258918 890946 ~ 891323 (-)
G217688 NA non-coding downstream 278960 870337 ~ 871281 (-)
G217785 NA non-coding upstream 824 1151289 ~ 1151708 (-)
G217789 NA non-coding upstream 4896 1155361 ~ 1155578 (-)
G217791 NA non-coding upstream 5352 1155817 ~ 1156050 (-)
G217813 NA non-coding upstream 27561 1178026 ~ 1178271 (-)
G218497 NA non-coding upstream 237792 1388257 ~ 1388513 (-)
CI01000051_00560810_00563417 NA other downstream 583086 560768 ~ 563417 (-)
CI01000051_00394082_00407612 MTMR9 other downstream 744446 392720 ~ 407612 (-)
CI01000051_00278614_00302552 NA other downstream 867612 278192 ~ 304373 (-)
CI01000051_00224709_00227613 NA other downstream 907215 224507 ~ 227613 (-)
CI01000051_01785489_01787612 IGFBP1A other upstream 558833 1784416 ~ 1787760 (-)
G218728 NA other upstream 1376878 2527343 ~ 2546459 (-)
G218861 NA other upstream 1689805 2840270 ~ 2840632 (-)
CI01000051_02955633_02960400 SCRN2 other upstream 1809123 2955380 ~ 2961148 (-)
G220041 NA other upstream 3005265 4155730 ~ 4158103 (-)

Expression


Co-expression Network