G218471


Basic Information

Item Value
gene id G218471
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 1707837 ~ 1762911 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU247805
CTCTTTTTCTATCTTGTAGGTGAGGTGTTGTGACTAGCATAGGACGTGCTGGTAGCACTCCTGCTGAGCGGGAAACTCAACATTGTCTCTGAGCCCTCCGTCCCTCGTCTCTTCAGCGGCAGTAGGGGAGGTTGAGCCACATCCAGACCCAGAGCCTCAAGACCCTCCACCGCCTCCAGCAGACTGCTCTCCAGAGAGGAGGTCAGGCTGCGAGGAGCTCCTCGAGGGGAGCTGTGGGAGTTGGGTGCCGAGAGGGTGAGGGGCGGGGAGGGCTGGGGGGTGTAGTGACTCAAGGGGGTGCTGGATCCACCCTCTAACCAGGAATGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU247805 True 327 lncRNA 0.60 2 1707837 1762911

Neighbor

gene id symbol gene type direction distance location
CI01000051_01644907_01652696 MCM3L, MCM3 coding downstream 55118 1644800 ~ 1652719 (-)
CI01000051_01560871_01627451 TRAPPC8 coding downstream 80172 1560828 ~ 1627665 (-)
CI01000051_01528013_01535266 OPN7A coding downstream 172571 1527909 ~ 1535266 (-)
CI01000051_01511542_01512516 NA coding downstream 195283 1511143 ~ 1512554 (-)
CI01000051_01468663_01486168 B4GALT5, B4GALT6 coding downstream 220665 1468419 ~ 1487172 (-)
CI01000051_01785489_01787612 IGFBP1A coding upstream 21571 1784416 ~ 1787760 (-)
CI01000051_01789888_01790134 NA coding upstream 26850 1789761 ~ 1790134 (-)
CI01000051_01809480_01841801 ADCY1A coding upstream 46569 1809480 ~ 1841801 (-)
CI01000051_01852579_01861297 NA coding upstream 89513 1852424 ~ 1861883 (-)
CI01000051_01894807_01902190 SIRT5 coding upstream 131408 1894319 ~ 1902190 (-)
G218578 NA non-coding downstream 16543 1691054 ~ 1691294 (-)
G218454 NA non-coding downstream 18626 1688421 ~ 1689211 (-)
G218576 NA non-coding downstream 23574 1683940 ~ 1684263 (-)
G218464 NA non-coding downstream 24569 1682910 ~ 1683268 (-)
G218575 NA non-coding downstream 28541 1678981 ~ 1679296 (-)
G218613 NA non-coding upstream 25415 1788326 ~ 1788896 (-)
G218617 NA non-coding upstream 33601 1796512 ~ 1796923 (-)
G218621 NA non-coding upstream 37966 1800877 ~ 1801108 (-)
G218629 NA non-coding upstream 101206 1864117 ~ 1864351 (-)
CI01000051_00560810_00563417 NA other downstream 1140682 560768 ~ 563417 (-)
CI01000051_00394082_00407612 MTMR9 other downstream 1302042 392720 ~ 407612 (-)
CI01000051_00278614_00302552 NA other downstream 1425208 278192 ~ 304373 (-)
CI01000051_00224709_00227613 NA other downstream 1464811 224507 ~ 227613 (-)
G218728 NA other upstream 764432 2527343 ~ 2546459 (-)
G218861 NA other upstream 1077359 2840270 ~ 2840632 (-)
CI01000051_02955633_02960400 SCRN2 other upstream 1196677 2955380 ~ 2961148 (-)
G220041 NA other upstream 2392819 4155730 ~ 4158103 (-)
G221575 NA other upstream 3751041 5513952 ~ 5518824 (-)

Expression


Co-expression Network