G218630


Basic Information

Item Value
gene id G218630
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 1866439 ~ 1866639 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU247967
TGAGTAAATCATGGGATAATTTTCATTTTTGGGTGAACTATCCCTTTAAGTAAATTCAGTCAAGCCTCTCGTACGTTTTTTTCTTCAGATTTTTTGTCTTTTGAAAGAATACCCTTTATTTTGTGTGGTCATAGTAATTTTAGTCTGTCTAAAATGTTTTCTTTTTAGTTAGATTAACATATTACTTGATTACTTCAAAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU247967 True 201 lncRNA 0.28 1 1866439 1866639

Neighbor

gene id symbol gene type direction distance location
CI01000051_01852579_01861297 NA coding downstream 4556 1852424 ~ 1861883 (-)
CI01000051_01809480_01841801 ADCY1A coding downstream 24638 1809480 ~ 1841801 (-)
CI01000051_01789888_01790134 NA coding downstream 76305 1789761 ~ 1790134 (-)
CI01000051_01785489_01787612 IGFBP1A coding downstream 78735 1784416 ~ 1787760 (-)
CI01000051_01716468_01720230 NA coding downstream 145531 1716459 ~ 1720908 (-)
CI01000051_01894807_01902190 SIRT5 coding upstream 27680 1894319 ~ 1902190 (-)
CI01000051_01915943_01920786 NA coding upstream 48735 1915374 ~ 1920786 (-)
CI01000051_01926867_01942055 DHCR24 coding upstream 60047 1926686 ~ 1942055 (-)
CI01000051_01989511_02060303 USP24 coding upstream 122832 1989471 ~ 2060303 (-)
CI01000051_02148607_02152701 NA coding upstream 281830 2148469 ~ 2153425 (-)
G218629 NA non-coding downstream 2088 1864117 ~ 1864351 (-)
G218621 NA non-coding downstream 65331 1800877 ~ 1801108 (-)
G218617 NA non-coding downstream 69516 1796512 ~ 1796923 (-)
G218613 NA non-coding downstream 77543 1788326 ~ 1788896 (-)
G218468 NA non-coding upstream 26206 1892845 ~ 1893626 (-)
G218641 NA non-coding upstream 80970 1947609 ~ 1947949 (-)
G218450 NA non-coding upstream 86167 1952806 ~ 1954033 (-)
G218475 NA non-coding upstream 93965 1960604 ~ 1960879 (-)
G218460 NA non-coding upstream 94418 1961057 ~ 1964366 (-)
CI01000051_00560810_00563417 NA other downstream 1299284 560768 ~ 563417 (-)
CI01000051_00394082_00407612 MTMR9 other downstream 1460644 392720 ~ 407612 (-)
CI01000051_00278614_00302552 NA other downstream 1583810 278192 ~ 304373 (-)
CI01000051_00224709_00227613 NA other downstream 1623413 224507 ~ 227613 (-)
G218728 NA other upstream 660704 2527343 ~ 2546459 (-)
G218861 NA other upstream 973631 2840270 ~ 2840632 (-)
CI01000051_02955633_02960400 SCRN2 other upstream 1092949 2955380 ~ 2961148 (-)
G220041 NA other upstream 2289091 4155730 ~ 4158103 (-)
G221575 NA other upstream 3647313 5513952 ~ 5518824 (-)

Expression


Co-expression Network