G218643


Basic Information

Item Value
gene id G218643
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 1974665 ~ 1974959 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU247980
GTGGTTCTCCCCCTTACTTTTCACATGATGAACACACGTGTATACATTTGCACATTTTCTATTCCTTAACGTACTGTACAGTACAATACACCAAACAACAACAAAAAATATTCTGCCCCAGCATCACGTCTTTGGTCTGGGACAGGCCAGAGAATCTCGTCAACTTCACAGTCTGTACTGGCCCTATCCAGGCAGCGGGGGGAAAATCCTCTTGCATGCCTGATCCACCCCTGGCACACATCAACTGAAATATCTAGTCAGGCTTCTTCCATTCCATCGTCTCTGAGTCCTACAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU247980 True 295 lncRNA 0.46 1 1974665 1974959

Neighbor

gene id symbol gene type direction distance location
CI01000051_01926867_01942055 DHCR24 coding downstream 32610 1926686 ~ 1942055 (-)
CI01000051_01915943_01920786 NA coding downstream 53879 1915374 ~ 1920786 (-)
CI01000051_01894807_01902190 SIRT5 coding downstream 72475 1894319 ~ 1902190 (-)
CI01000051_01852579_01861297 NA coding downstream 112782 1852424 ~ 1861883 (-)
CI01000051_01809480_01841801 ADCY1A coding downstream 132864 1809480 ~ 1841801 (-)
CI01000051_01989511_02060303 USP24 coding upstream 14512 1989471 ~ 2060303 (-)
CI01000051_02148607_02152701 NA coding upstream 173510 2148469 ~ 2153425 (-)
CI01000051_02297468_02301682 PLPP3 coding upstream 321942 2296901 ~ 2311967 (-)
CI01000051_02359343_02360115 NA coding upstream 384132 2359091 ~ 2360115 (-)
CI01000051_02362692_02367269 NA coding upstream 386808 2361767 ~ 2367269 (-)
G218461 NA non-coding downstream 5834 1964836 ~ 1968831 (-)
G218460 NA non-coding downstream 10299 1961057 ~ 1964366 (-)
G218475 NA non-coding downstream 13786 1960604 ~ 1960879 (-)
G218450 NA non-coding downstream 20632 1952806 ~ 1954033 (-)
G218641 NA non-coding downstream 26716 1947609 ~ 1947949 (-)
G218466 NA non-coding upstream 1168 1976127 ~ 1976492 (-)
G218645 NA non-coding upstream 1862 1976821 ~ 1977056 (-)
G218650 NA non-coding upstream 94066 2069025 ~ 2069249 (-)
G218770 NA non-coding upstream 231983 2206942 ~ 2207172 (-)
CI01000051_01785489_01787612 IGFBP1A other downstream 186905 1784416 ~ 1787760 (-)
CI01000051_00560810_00563417 NA other downstream 1407510 560768 ~ 563417 (-)
CI01000051_00394082_00407612 MTMR9 other downstream 1568870 392720 ~ 407612 (-)
CI01000051_00278614_00302552 NA other downstream 1692036 278192 ~ 304373 (-)
CI01000051_00224709_00227613 NA other downstream 1731639 224507 ~ 227613 (-)
G218728 NA other upstream 552384 2527343 ~ 2546459 (-)
G218861 NA other upstream 865311 2840270 ~ 2840632 (-)
CI01000051_02955633_02960400 SCRN2 other upstream 984629 2955380 ~ 2961148 (-)
G220041 NA other upstream 2180771 4155730 ~ 4158103 (-)
G221575 NA other upstream 3538993 5513952 ~ 5518824 (-)

Expression


Co-expression Network