G218645


Basic Information

Item Value
gene id G218645
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 1976821 ~ 1977056 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU247982
GGAGAGGAAAAATATTCCAAAACTTAAATACAATATGAGAATTAACTGTACAATTACTAGAAATGTGTACCTTGGATATTATACATATATTATATATATATGATGTCCATGGATTTTTGGTCATCTAAAGTGTCCTTTTTTCACATTAATATATTGGGGCTAACAATGTGCCTGCTACTTTAGACGAAATATATATGTAAAAGTGCATCTTGTTCATTAGTTTTACTTTATTATTT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU247982 True 236 lncRNA 0.27 1 1976821 1977056

Neighbor

gene id symbol gene type direction distance location
CI01000051_01926867_01942055 DHCR24 coding downstream 34766 1926686 ~ 1942055 (-)
CI01000051_01915943_01920786 NA coding downstream 56035 1915374 ~ 1920786 (-)
CI01000051_01894807_01902190 SIRT5 coding downstream 74631 1894319 ~ 1902190 (-)
CI01000051_01852579_01861297 NA coding downstream 114938 1852424 ~ 1861883 (-)
CI01000051_01809480_01841801 ADCY1A coding downstream 135020 1809480 ~ 1841801 (-)
CI01000051_01989511_02060303 USP24 coding upstream 12415 1989471 ~ 2060303 (-)
CI01000051_02148607_02152701 NA coding upstream 171413 2148469 ~ 2153425 (-)
CI01000051_02297468_02301682 PLPP3 coding upstream 319845 2296901 ~ 2311967 (-)
CI01000051_02359343_02360115 NA coding upstream 382035 2359091 ~ 2360115 (-)
CI01000051_02362692_02367269 NA coding upstream 384711 2361767 ~ 2367269 (-)
G218466 NA non-coding downstream 329 1976127 ~ 1976492 (-)
G218643 NA non-coding downstream 1862 1974665 ~ 1974959 (-)
G218461 NA non-coding downstream 7990 1964836 ~ 1968831 (-)
G218460 NA non-coding downstream 12455 1961057 ~ 1964366 (-)
G218475 NA non-coding downstream 15942 1960604 ~ 1960879 (-)
G218650 NA non-coding upstream 91969 2069025 ~ 2069249 (-)
G218770 NA non-coding upstream 229886 2206942 ~ 2207172 (-)
G218734 NA non-coding upstream 335041 2312097 ~ 2316726 (-)
G218716 NA non-coding upstream 373425 2350481 ~ 2354144 (-)
CI01000051_01785489_01787612 IGFBP1A other downstream 189061 1784416 ~ 1787760 (-)
CI01000051_00560810_00563417 NA other downstream 1409666 560768 ~ 563417 (-)
CI01000051_00394082_00407612 MTMR9 other downstream 1571026 392720 ~ 407612 (-)
CI01000051_00278614_00302552 NA other downstream 1694192 278192 ~ 304373 (-)
CI01000051_00224709_00227613 NA other downstream 1733795 224507 ~ 227613 (-)
G218728 NA other upstream 550287 2527343 ~ 2546459 (-)
G218861 NA other upstream 863214 2840270 ~ 2840632 (-)
CI01000051_02955633_02960400 SCRN2 other upstream 982532 2955380 ~ 2961148 (-)
G220041 NA other upstream 2178674 4155730 ~ 4158103 (-)
G221575 NA other upstream 3536896 5513952 ~ 5518824 (-)

Expression


Co-expression Network