G218650



Basic Information


Item Value
gene id G218650
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 2069025 ~ 2069249 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU247987
GTTTTGGTCGATCGGATCACAAGTGGACGACAATAAATACAGGTGTAAACTGGGTGTAAAACGTTTTGAGCTTGTCCACTTTTGACCACTTCCAGAGGAATTTGAAAACACATTAGACCGGATTGCTTTCACAGTGTAAACGCTCAAAATGTGTTCGAACAGCCACTAAAGACCGCCTGCTCTCCACCTACTGACCTAATGCGTAAACATTATCAGATCCATCTG

Function


NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU247987 True 225 lncRNA 0.43 1 2069025 2069249

Neighbor


gene id symbol gene type direction distance location
CI01000051_01989511_02060303 USP24 coding downstream 8722 1989471 ~ 2060303 (-)
CI01000051_01926867_01942055 DHCR24 coding downstream 126970 1926686 ~ 1942055 (-)
CI01000051_01915943_01920786 NA coding downstream 148239 1915374 ~ 1920786 (-)
CI01000051_01894807_01902190 SIRT5 coding downstream 166835 1894319 ~ 1902190 (-)
CI01000051_01852579_01861297 NA coding downstream 207142 1852424 ~ 1861883 (-)
CI01000051_02148607_02152701 NA coding upstream 79220 2148469 ~ 2153425 (-)
CI01000051_02297468_02301682 PLPP3 coding upstream 227652 2296901 ~ 2311967 (-)
CI01000051_02359343_02360115 NA coding upstream 289842 2359091 ~ 2360115 (-)
CI01000051_02362692_02367269 NA coding upstream 292518 2361767 ~ 2367269 (-)
CI01000051_02391113_02451758 NA coding upstream 320633 2389882 ~ 2451758 (-)
G218645 NA non-coding downstream 91969 1976821 ~ 1977056 (-)
G218466 NA non-coding downstream 92533 1976127 ~ 1976492 (-)
G218643 NA non-coding downstream 94066 1974665 ~ 1974959 (-)
G218461 NA non-coding downstream 100194 1964836 ~ 1968831 (-)
G218460 NA non-coding downstream 104659 1961057 ~ 1964366 (-)
G218770 NA non-coding upstream 137693 2206942 ~ 2207172 (-)
G218734 NA non-coding upstream 242848 2312097 ~ 2316726 (-)
G218716 NA non-coding upstream 281232 2350481 ~ 2354144 (-)
G218748 NA non-coding upstream 323162 2392411 ~ 2395777 (-)
CI01000051_01785489_01787612 IGFBP1A other downstream 281265 1784416 ~ 1787760 (-)
CI01000051_00560810_00563417 NA other downstream 1501870 560768 ~ 563417 (-)
CI01000051_00394082_00407612 MTMR9 other downstream 1663230 392720 ~ 407612 (-)
CI01000051_00278614_00302552 NA other downstream 1786396 278192 ~ 304373 (-)
CI01000051_00224709_00227613 NA other downstream 1825999 224507 ~ 227613 (-)
G218728 NA other upstream 458094 2527343 ~ 2546459 (-)
G218861 NA other upstream 771021 2840270 ~ 2840632 (-)
CI01000051_02955633_02960400 SCRN2 other upstream 890339 2955380 ~ 2961148 (-)
G220041 NA other upstream 2086481 4155730 ~ 4158103 (-)
G221575 NA other upstream 3444703 5513952 ~ 5518824 (-)

Expression



Co-expression Network