XLOC_009719 (CU929328.1)



Basic Information


Item Value
gene id XLOC_009719
gene name CU929328.1
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information


Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 10387719 ~ 10389787 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence


>TCONS_00019461
AAGAATAACGACAGAGTTATAAATGAGTTGATGTCAAGTACCTTCAGTTTGAGAAGACAGGAGATTGTTGGTCAAGCCCCAGGTGTCACAGATCTTCTAGAGAGATGGCCCGCCCTCTTTAAACCTTCACAGATCTGTGAAGAGTTCTTGAGAATCAATGGCATATCACTTGAGTCAACATTTATGTCACAGCTGGACAGACATACCCCAAGGATGTTGTCACTTTTCAATGAAAAGGGAGGAGCAGTTGGTCAAAGAATCAAGGTCGAAATGATGAAACTCATCCAGGATCCATCTGCCTCTGTAGACAAAAGGAGAGAAGTGGTTCTGAGATGCC

Function


GO:

id name namespace
GO:0003261 cardiac muscle progenitor cell migration to the midline involved in heart field formation biological_process

KEGG: NA

Ensembl:

ensembl_id ENSDARG00000105332

RNA


RNA id representative length rna type GC content exon number start site end site
TCONS_00019461 True 337 lncRNA 0.43 3 10387719 10389787

Neighbor


gene id symbol gene type direction distance location
XLOC_009718 NA coding upstream 7898 10378331 ~ 10379821 (+)
XLOC_009717 si:dkeyp-77h1.4 coding upstream 18421 10346277 ~ 10369298 (+)
XLOC_009716 mdc1 coding upstream 41950 10329701 ~ 10345769 (+)
XLOC_009714 tubb5 coding upstream 60099 10318893 ~ 10327620 (+)
XLOC_009715 FP016064.1 coding upstream 63054 10324549 ~ 10324665 (+)
XLOC_009720 ino80e coding downstream 23764 10413551 ~ 10422490 (+)
XLOC_009721 ino80e coding downstream 33049 10422836 ~ 10428899 (+)
XLOC_009722 vars1 coding downstream 39983 10429770 ~ 10475814 (+)
XLOC_009723 si:ch73-22o12.1 coding downstream 167717 10557504 ~ 10638020 (+)
XLOC_009724 NA coding downstream 227567 10617354 ~ 10617686 (+)
XLOC_009712 NA non-coding upstream 371006 10012335 ~ 10016713 (+)
XLOC_009704 NA non-coding upstream 859413 9526080 ~ 9528306 (+)
XLOC_009703 NA non-coding upstream 871912 9515326 ~ 9515807 (+)
XLOC_009733 NA non-coding downstream 971973 11361760 ~ 11376845 (+)
XLOC_009736 NA non-coding downstream 1183402 11573189 ~ 11578407 (+)
XLOC_009737 NA non-coding downstream 1190865 11580652 ~ 11583878 (+)
XLOC_009751 NA non-coding downstream 1727844 12117631 ~ 12139336 (+)

Expression



Co-expression Network