G219434


Basic Information

Item Value
gene id G219434
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 4032479 ~ 4032755 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU248885
CTTCAGACCACTGTCAAGACAAACTAGCTTCTTTGCCCTTCCATTGCATGCATCCGTCAAATAGATTTCAGCCATCTCCATCATTATGAATGTTCTGTACTTGTGAGTCTGTAAAAAAAACGTAAAGACAGGATCTTGATGAGCTTTAAAGATTTCATATAGTTACCTGATCTATGCACTTTAAAGAGAAAGCTGATATTGCCTTTTTTAAAAGTTAAGGAATCTAATAAACAAATGAGAATATAACAAGATTAAAAAGAGTTCACTTCAACTATAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU248885 True 277 lncRNA 0.33 1 4032479 4032755

Neighbor

gene id symbol gene type direction distance location
CI01000051_03800655_03819155 ZYG11B, ZYG11 coding upstream 213282 3800655 ~ 3819197 (+)
CI01000051_03687377_03698806 ANGPTL1A, ANGPTL1 coding upstream 333516 3687324 ~ 3698963 (+)
CI01000051_03679568_03682342 NA coding upstream 349951 3679437 ~ 3682528 (+)
CI01000051_03457204_03459579 NA coding upstream 572555 3456959 ~ 3459924 (+)
CI01000051_03443548_03451188 NA coding upstream 580665 3443548 ~ 3451814 (+)
CI01000051_04038453_04045552 TMEM30A, TMEM30AA, TMEM30AB coding downstream 5652 4038407 ~ 4046528 (+)
CI01000051_04071144_04075444 KCNK13B coding downstream 38389 4070951 ~ 4077125 (+)
CI01000051_04081532_04085798 PSMC1B, PSMC1, PSMC1A, PSMC1.L coding downstream 48777 4081532 ~ 4085922 (+)
CI01000051_04094412_04101387 CALM2, CALM3, CALM1 coding downstream 61599 4094354 ~ 4101516 (+)
CI01000051_04155754_04157992 NFKBIAA coding downstream 122929 4155684 ~ 4158329 (+)
G219431 NA non-coding upstream 2534 4029739 ~ 4029945 (+)
G219429 NA non-coding upstream 4432 4027822 ~ 4028047 (+)
G219428 NA non-coding upstream 5446 4026826 ~ 4027033 (+)
G219414 NA non-coding upstream 18248 4014015 ~ 4014231 (+)
G219409 NA non-coding upstream 22064 4010179 ~ 4010415 (+)
G219438 NA non-coding downstream 18340 4051095 ~ 4051643 (+)
G219439 NA non-coding downstream 22357 4055112 ~ 4055966 (+)
G219440 NA non-coding downstream 23444 4056199 ~ 4056441 (+)
G219451 NA non-coding downstream 30499 4063254 ~ 4063453 (+)
G219452 NA non-coding downstream 31646 4064401 ~ 4064853 (+)
G218981 NA other upstream 785606 3245443 ~ 3246873 (+)
CI01000051_02060996_02061735 NA other upstream 1966396 2060534 ~ 2062355 (+)
CI01000051_00638200_00720543 CDC42BPB other upstream 3307775 637590 ~ 720669 (+)
G217075 NA other upstream 3648351 324465 ~ 384128 (+)
CI01000051_04374052_04393328 NA other downstream 341655 4372658 ~ 4393677 (+)
G219803 NA other downstream 882219 4914974 ~ 5052033 (+)
CI01000051_06825895_06830637 NA other downstream 2793044 6825895 ~ 6830637 (+)
G221319 NA other downstream 3309286 7342041 ~ 7342546 (+)
G221386 NA other downstream 3376768 7401175 ~ 7413007 (+)

Expression


Co-expression Network