G219547


Basic Information

Item Value
gene id G219547
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 4249866 ~ 4250085 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU249016
GGTGCATCCCGTGAGTATTAAACTAAGTTCTCTTTCATGTCTTATTGTGCTTAAACTGTCAAAAATACACAAAGTTCACATAAACACAGTGAGTTATGTCTGTGAATGTAAACAGCAAGTAATGTGTCTATATTAGATTTGTGTATTAAAGGGGTGGTTGATTATGATTTCACTTTTTTAACTTTAGTTAGTGTGTAATGTTGCTGTTTGAGCATAAAAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU249016 True 220 lncRNA 0.32 1 4249866 4250085

Neighbor

gene id symbol gene type direction distance location
CI01000051_04155754_04157992 NFKBIAA coding upstream 91537 4155684 ~ 4158329 (+)
CI01000051_04094412_04101387 CALM2, CALM3, CALM1 coding upstream 148350 4094354 ~ 4101516 (+)
CI01000051_04081532_04085798 PSMC1B, PSMC1, PSMC1A, PSMC1.L coding upstream 163944 4081532 ~ 4085922 (+)
CI01000051_04071144_04075444 KCNK13B coding upstream 172741 4070951 ~ 4077125 (+)
CI01000051_04038453_04045552 TMEM30A, TMEM30AA, TMEM30AB coding upstream 203338 4038407 ~ 4046528 (+)
CI01000051_04374052_04393328 NA coding downstream 122573 4372658 ~ 4393677 (+)
CI01000051_04419475_04464134 NA coding downstream 169185 4419270 ~ 4464166 (+)
CI01000051_04763063_04778692 NA coding downstream 512411 4762496 ~ 4779082 (+)
CI01000051_04796878_04799272 FLRT2 coding downstream 546793 4796878 ~ 4799321 (+)
CI01000051_05072860_05074568 GLRX5 coding downstream 822544 5072629 ~ 5074874 (+)
G219543 NA non-coding upstream 2047 4247618 ~ 4247819 (+)
G219539 NA non-coding upstream 4017 4245178 ~ 4245849 (+)
G219534 NA non-coding upstream 12749 4236696 ~ 4237117 (+)
G219497 NA non-coding upstream 52721 4196527 ~ 4197145 (+)
G219484 NA non-coding upstream 95100 4154442 ~ 4154766 (+)
G219552 NA non-coding downstream 6675 4256760 ~ 4256981 (+)
G219559 NA non-coding downstream 27335 4277420 ~ 4278285 (+)
G219563 NA non-coding downstream 37002 4287087 ~ 4287400 (+)
G219564 NA non-coding downstream 41564 4291649 ~ 4291855 (+)
G219580 NA non-coding downstream 82737 4332822 ~ 4333037 (+)
G218981 NA other upstream 1002993 3245443 ~ 3246873 (+)
CI01000051_02060996_02061735 NA other upstream 2183783 2060534 ~ 2062355 (+)
CI01000051_00638200_00720543 CDC42BPB other upstream 3525162 637590 ~ 720669 (+)
G217075 NA other upstream 3865738 324465 ~ 384128 (+)
G219803 NA other downstream 664889 4914974 ~ 5052033 (+)
CI01000051_06825895_06830637 NA other downstream 2575714 6825895 ~ 6830637 (+)
G221319 NA other downstream 3091956 7342041 ~ 7342546 (+)
G221386 NA other downstream 3159438 7401175 ~ 7413007 (+)

Expression


Co-expression Network