G220844


Basic Information

Item Value
gene id G220844
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 5483505 ~ 5484126 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU250466
AGGCTGCAACCTCTAGTTTCAGTCGCTAGAGCATCTCTTGAGATCAGAGGAGTGAGGTTTACTTGCACAGTAACTACTAGCTGGCCTCCGTTACACTCACCCCCCAAACCTCACTCCCATCCGGGTCACAGCACCAATGTAACCCCTCAGCCAAGTCCTATTCGCCCTGCTCTGAGCGGGTCTCGAACCTGGGTCTCCGGAGTGGGAGTCGGACGCTCTACCAAGGAGGCTAAAGGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU250466 True 237 lncRNA 0.56 2 5483505 5484126

Neighbor

gene id symbol gene type direction distance location
CI01000051_05454570_05480649 NA coding upstream 2570 5454532 ~ 5480935 (+)
CI01000051_05401881_05405868 NA coding upstream 77619 5401881 ~ 5405886 (+)
CI01000051_05320361_05322570 GJD2B, GJD2 coding upstream 159600 5320361 ~ 5323905 (+)
CI01000051_05314994_05317995 ACTC1B, ACTA2, ACTA1, MGC53823, ACTC1, MGC75582, ACT3, ACTC1A, ACTA1A, ACT2, ACTC1.L coding upstream 165320 5314444 ~ 5318185 (+)
CI01000051_05296858_05301152 NA coding upstream 182171 5296684 ~ 5301334 (+)
CI01000051_05514127_05516929 ZFP36L1B, ZFP36L1 coding downstream 28630 5512756 ~ 5517785 (+)
CI01000051_05523573_05525861 NA coding downstream 39236 5523362 ~ 5527007 (+)
CI01000051_05579061_05584087 CRIP2 coding downstream 94935 5579061 ~ 5584087 (+)
CI01000051_05588671_05593438 RDH14B coding downstream 104166 5588292 ~ 5593977 (+)
CI01000051_05657394_05672861 SYT14B, SYT14 coding downstream 173268 5657394 ~ 5674202 (+)
G220830 NA non-coding upstream 50295 5432944 ~ 5433210 (+)
G220773 NA non-coding upstream 76833 5348807 ~ 5406672 (+)
G220807 NA non-coding upstream 106980 5375682 ~ 5376525 (+)
G220730 NA non-coding upstream 277877 5205426 ~ 5205628 (+)
G220727 NA non-coding upstream 280754 5202409 ~ 5202751 (+)
G220846 NA non-coding downstream 1352 5485478 ~ 5485721 (+)
G220850 NA non-coding downstream 5942 5490068 ~ 5490287 (+)
G220856 NA non-coding downstream 13978 5498104 ~ 5498659 (+)
G220861 NA non-coding downstream 37731 5521857 ~ 5522786 (+)
G220889 NA non-coding downstream 87332 5571458 ~ 5571737 (+)
G219803 NA other upstream 431472 4914974 ~ 5052033 (+)
CI01000051_04374052_04393328 NA other upstream 1108175 4372658 ~ 4393677 (+)
G218981 NA other upstream 2236632 3245443 ~ 3246873 (+)
CI01000051_02060996_02061735 NA other upstream 3417422 2060534 ~ 2062355 (+)
CI01000051_00638200_00720543 CDC42BPB other upstream 4758801 637590 ~ 720669 (+)
CI01000051_06825895_06830637 NA other downstream 1341673 6825895 ~ 6830637 (+)
G221319 NA other downstream 1857915 7342041 ~ 7342546 (+)
G221386 NA other downstream 1925397 7401175 ~ 7413007 (+)
CI01000051_08211233_08214513 NA other downstream 2621517 8209722 ~ 8214696 (+)
G222727 NA other downstream 2858816 8342942 ~ 8343448 (+)

Expression


Co-expression Network