G220922


Basic Information

Item Value
gene id G220922
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 5676464 ~ 5676963 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU250571
TAGACGTTTATCAAAAAGAATGAATTCTTGACCAAAATCCATAATCAGTCAGGTGGTAAGATTGAGTTACATCCCATAACACATCTTTCATTAAGAAATCTTTCATGAGGAGGCAATTTTCTGGAAGCCTGAGTAGGTGCTTCTTCAGTAGGCCCATGTTTAAACATCCAAAGTGCAAGTTGAACAGCCACAGAACTGCTACAGCATTCAAGACAGCAGGTATGCTCAAGAATTCATAATACATGAACTACATGGCATGCTATCTGCAGTGTGCAAATATTGCAAAAACAACCTACAACATTTGCCAAAATGTTCAGTACAATGAAACAACACTGTGTGGAATACTGTATCCCACAATGCAGTGAGATCAACTTGATCTTTCATTTCCAGTTTGACTGGAAATAAACTTGAAGCACTATAAAACACAAAATCGAACAGCTCTTTCTTAAAGGGATAGTTCACCCAAAAATGAAAATTATGTCATCATTTACTCACCCTCA

Function

NR:

description
PREDICTED: uncharacterized protein LOC107395943

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU250571 True 500 lncRNA 0.37 1 5676464 5676963

Neighbor

gene id symbol gene type direction distance location
CI01000051_05657394_05672861 SYT14B, SYT14 coding upstream 2262 5657394 ~ 5674202 (+)
CI01000051_05588671_05593438 RDH14B coding upstream 82487 5588292 ~ 5593977 (+)
CI01000051_05579061_05584087 CRIP2 coding upstream 92377 5579061 ~ 5584087 (+)
CI01000051_05523573_05525861 NA coding upstream 149457 5523362 ~ 5527007 (+)
CI01000051_05514127_05516929 ZFP36L1B, ZFP36L1 coding upstream 158679 5512756 ~ 5517785 (+)
CI01000051_05712567_05728993 YLPM1 coding downstream 35604 5712567 ~ 5729691 (+)
CI01000051_05757566_05757955 C12ORF57 coding downstream 80603 5757566 ~ 5758141 (+)
CI01000051_05831209_05933202 DLGAP2 coding downstream 154246 5831209 ~ 5933637 (+)
CI01000051_05935542_05939529 NA coding downstream 258480 5935443 ~ 5939632 (+)
CI01000051_05955881_05966250 NA coding downstream 278454 5955417 ~ 5966425 (+)
G220889 NA non-coding upstream 104727 5571458 ~ 5571737 (+)
G220861 NA non-coding upstream 153678 5521857 ~ 5522786 (+)
G220856 NA non-coding upstream 177805 5498104 ~ 5498659 (+)
G220850 NA non-coding upstream 186177 5490068 ~ 5490287 (+)
G220846 NA non-coding upstream 190743 5485478 ~ 5485721 (+)
G220930 NA non-coding downstream 62616 5739579 ~ 5740171 (+)
G220916 NA non-coding downstream 64095 5741058 ~ 5744465 (+)
G220923 NA non-coding downstream 112565 5789528 ~ 5830106 (+)
G220920 NA non-coding downstream 268627 5945590 ~ 5946344 (+)
G220983 NA non-coding downstream 312843 5989806 ~ 5990114 (+)
G219803 NA other upstream 624431 4914974 ~ 5052033 (+)
CI01000051_04374052_04393328 NA other upstream 1301134 4372658 ~ 4393677 (+)
G218981 NA other upstream 2429591 3245443 ~ 3246873 (+)
CI01000051_02060996_02061735 NA other upstream 3610381 2060534 ~ 2062355 (+)
CI01000051_00638200_00720543 CDC42BPB other upstream 4951760 637590 ~ 720669 (+)
CI01000051_06825895_06830637 NA other downstream 1148836 6825895 ~ 6830637 (+)
G221319 NA other downstream 1665078 7342041 ~ 7342546 (+)
G221386 NA other downstream 1732560 7401175 ~ 7413007 (+)
CI01000051_08211233_08214513 NA other downstream 2428680 8209722 ~ 8214696 (+)
G222727 NA other downstream 2665979 8342942 ~ 8343448 (+)

Expression


Co-expression Network