G221780


Basic Information

Item Value
gene id G221780
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 5855672 ~ 5909748 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU251559
AGACATTCTATAGCAAGGCAGTGGTCGTCTTGGAGGTGTGTTTGGGGTCGTTATCATGTTGGAATACTGCCCTGCGGCCCAGTCTCCGAAGGGAGGGGATCATGCTCTGTTGGCATTCATGGTTCCCTCAATGAACTGTAGCTCCCCAGTGCCGGCAGCACTCATGCAGCCCCAGACCATGACACTCCCACCACCATGCTTGACTGTAGGCAAGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU251559 True 215 lncRNA 0.55 2 5855672 5909748

Neighbor

gene id symbol gene type direction distance location
CI01000051_05752434_05755144 NA coding downstream 100528 5752290 ~ 5755144 (-)
CI01000051_05743847_05749675 BPNT1 coding downstream 105997 5743671 ~ 5749675 (-)
CI01000051_05690134_05690418 NA coding downstream 165254 5689547 ~ 5690418 (-)
CI01000051_05679116_05685755 KCNK5B coding downstream 169716 5678771 ~ 5685956 (-)
CI01000051_05646139_05649781 5NT1A, NT5C1BB, NT5C1A coding downstream 205724 5645678 ~ 5649948 (-)
CI01000051_05949486_05950751 KCNS3B coding upstream 39595 5949343 ~ 5950853 (-)
CI01000051_06015846_06019716 RD3 coding upstream 105959 6015707 ~ 6019716 (-)
CI01000051_06033224_06041180 SLC30A1A coding upstream 123294 6033042 ~ 6041180 (-)
CI01000051_06041891_06047349 NEK2 coding upstream 131871 6041619 ~ 6047710 (-)
CI01000051_06052696_06090422 LPGAT1 coding upstream 141305 6051053 ~ 6090422 (-)
G221745 NA non-coding downstream 87080 5768371 ~ 5768592 (-)
G221744 NA non-coding downstream 92700 5762651 ~ 5762972 (-)
G221742 NA non-coding downstream 96337 5759113 ~ 5759335 (-)
G221735 NA non-coding downstream 151505 5703909 ~ 5704167 (-)
G221717 NA non-coding downstream 204572 5650870 ~ 5651100 (-)
G221804 NA non-coding upstream 38672 5948420 ~ 5948656 (-)
G221822 NA non-coding upstream 68993 5978741 ~ 5978996 (-)
G221825 NA non-coding upstream 74615 5984363 ~ 5987132 (-)
G221830 NA non-coding upstream 107885 6017633 ~ 6017970 (-)
G221836 NA non-coding upstream 190811 6100559 ~ 6100763 (-)
G221575 NA other downstream 336848 5513952 ~ 5518824 (-)
G220041 NA other downstream 1697569 4155730 ~ 4158103 (-)
CI01000051_02955633_02960400 SCRN2 other downstream 2894178 2955380 ~ 2961148 (-)
G218861 NA other downstream 3015040 2840270 ~ 2840632 (-)
G218728 NA other downstream 3309213 2527343 ~ 2546459 (-)
G221840 NA other upstream 223025 6132773 ~ 6133579 (-)
G222729 NA other upstream 2432401 8342149 ~ 8342652 (-)
G222730 NA other upstream 2433222 8342970 ~ 8343438 (-)

Expression


Co-expression Network