G220920


Basic Information

Item Value
gene id G220920
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 5945590 ~ 5946344 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU250569
ACCACACACCACCTTTTCATTTGTCAGTCATTCAAGGCTTCTCTGCTAAGAAATCACAATATCGTAGGCAGTTGAGTGAATGTTCAGCTGTGTAGAACTTCAGTACAGATGTTTCGCTGCCTGTTCAGCAATAACCTGAATGGTTTCATTAAATTTCATGGCACAGACACAATTTGACATCCTCGCTTTGGTAGACTATATGGAAATAGTGATTCTTTCCATTTACAATGCTCTGAATAATCGAAGTCTTAGACAAAGCAGGATGTTGAGATTTGTCTGTGATGCTCTGATGACTTTTCTGAGTGTGAGGTGAGATTCCAGGCAGTTTTGCTATGTATTCACAGTTTTCACTCTCAAATGTTAACCATAACCCTAAAATGAAAATACAGTACTTTGGTCATAGTTTTCCATGACTAACTCATCAAGGGGAGGGATTTTCTCTTTTTTTTTCCAGCACATCTGATGTAATGTTGTTTGAATACGTGAGACCTCTCATAAATGGGCTATAACAGTGAGTTTTGAGAAAAGTTTGGCTTCAAACTTGTTTTGAATCATTAAATATATCAATAATGAGGAGAATCTAATGCCAAATATACATTATTTATAGAAAAATATATACATATATTGATAAATGAATATATGCCTAATTTAAATAGATTTTTTTTTGCTCTAACCCATGTTTATTTGAACTTTATCAAGATTATTTTATAAAGCTATGACAGCATGCCGGATCGTAACAAAAATTGAATGTATGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU250569 True 755 lncRNA 0.34 1 5945590 5946344

Neighbor

gene id symbol gene type direction distance location
CI01000051_05935542_05939529 NA coding upstream 5958 5935443 ~ 5939632 (+)
CI01000051_05831209_05933202 DLGAP2 coding upstream 11953 5831209 ~ 5933637 (+)
CI01000051_05757566_05757955 C12ORF57 coding upstream 187449 5757566 ~ 5758141 (+)
CI01000051_05712567_05728993 YLPM1 coding upstream 215899 5712567 ~ 5729691 (+)
CI01000051_05657394_05672861 SYT14B, SYT14 coding upstream 271388 5657394 ~ 5674202 (+)
CI01000051_05955881_05966250 NA coding downstream 9073 5955417 ~ 5966425 (+)
CI01000051_05969849_05970699 NA coding downstream 23505 5969849 ~ 5971469 (+)
CI01000051_05996289_06007664 RHAG coding downstream 49651 5995995 ~ 6008558 (+)
CI01000051_06113450_06128623 TAGAPB coding downstream 167106 6113450 ~ 6129084 (+)
CI01000051_06136031_06140543 RSPH3 coding downstream 189687 6136031 ~ 6140633 (+)
G220923 NA non-coding upstream 115484 5789528 ~ 5830106 (+)
G220916 NA non-coding upstream 201125 5741058 ~ 5744465 (+)
G220930 NA non-coding upstream 205419 5739579 ~ 5740171 (+)
G220922 NA non-coding upstream 268627 5676464 ~ 5676963 (+)
G220889 NA non-coding upstream 373853 5571458 ~ 5571737 (+)
G220983 NA non-coding downstream 43462 5989806 ~ 5990114 (+)
G220967 NA non-coding downstream 68829 6015173 ~ 6016182 (+)
G220991 NA non-coding downstream 72977 6019321 ~ 6019978 (+)
G220993 NA non-coding downstream 74559 6020903 ~ 6021164 (+)
G220992 NA non-coding downstream 76603 6022947 ~ 6023186 (+)
G219803 NA other upstream 893557 4914974 ~ 5052033 (+)
CI01000051_04374052_04393328 NA other upstream 1570260 4372658 ~ 4393677 (+)
G218981 NA other upstream 2698717 3245443 ~ 3246873 (+)
CI01000051_02060996_02061735 NA other upstream 3879507 2060534 ~ 2062355 (+)
CI01000051_00638200_00720543 CDC42BPB other upstream 5220886 637590 ~ 720669 (+)
CI01000051_06825895_06830637 NA other downstream 879455 6825895 ~ 6830637 (+)
G221319 NA other downstream 1395697 7342041 ~ 7342546 (+)
G221386 NA other downstream 1463179 7401175 ~ 7413007 (+)
CI01000051_08211233_08214513 NA other downstream 2159299 8209722 ~ 8214696 (+)
G222727 NA other downstream 2396598 8342942 ~ 8343448 (+)

Expression


Co-expression Network