G220996


Basic Information

Item Value
gene id G220996
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 6025733 ~ 6025954 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU250666
GAAGAAAATTACCTATCCAGTGTCTTTTGTTAATCAGGTCTGACATATAGAAGTTATAATGAGCCCTTTCCAGACCTTTCTACTGTGAGGTTTAGAAGAACTCATTAGAGAAAACAAGTAAAATTGAGCTTTTCTCATTTATAAACTTGAAATTGTTTGAAAAGCAAAAACAGTTTCATTGCCATACTGAAATAGCATGTTCATATTCTTGTAAACAGTAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU250666 True 222 lncRNA 0.32 1 6025733 6025954

Neighbor

gene id symbol gene type direction distance location
CI01000051_05996289_06007664 RHAG coding upstream 17175 5995995 ~ 6008558 (+)
CI01000051_05969849_05970699 NA coding upstream 54264 5969849 ~ 5971469 (+)
CI01000051_05955881_05966250 NA coding upstream 59308 5955417 ~ 5966425 (+)
CI01000051_05935542_05939529 NA coding upstream 86101 5935443 ~ 5939632 (+)
CI01000051_05831209_05933202 DLGAP2 coding upstream 92096 5831209 ~ 5933637 (+)
CI01000051_06113450_06128623 TAGAPB coding downstream 87496 6113450 ~ 6129084 (+)
CI01000051_06136031_06140543 RSPH3 coding downstream 110077 6136031 ~ 6140633 (+)
CI01000051_06155906_06164505 EZRB, RDX, EZR coding downstream 129952 6155906 ~ 6164505 (+)
CI01000051_06167413_06171890 NA coding downstream 141249 6167203 ~ 6172507 (+)
CI01000051_06286985_06304439 KCNK3A, KCNK3 coding downstream 261031 6286985 ~ 6304439 (+)
G220995 NA non-coding upstream 1603 6023899 ~ 6024130 (+)
G220992 NA non-coding upstream 2547 6022947 ~ 6023186 (+)
G220993 NA non-coding upstream 4569 6020903 ~ 6021164 (+)
G220991 NA non-coding upstream 5755 6019321 ~ 6019978 (+)
G220967 NA non-coding upstream 9551 6015173 ~ 6016182 (+)
G220998 NA non-coding downstream 661 6026615 ~ 6026902 (+)
G220966 NA non-coding downstream 62545 6088499 ~ 6090361 (+)
G221001 NA non-coding downstream 66517 6092471 ~ 6092694 (+)
G221008 NA non-coding downstream 106978 6132932 ~ 6133608 (+)
G221026 NA non-coding downstream 168894 6194848 ~ 6195162 (+)
G219803 NA other upstream 973700 4914974 ~ 5052033 (+)
CI01000051_04374052_04393328 NA other upstream 1650403 4372658 ~ 4393677 (+)
G218981 NA other upstream 2778860 3245443 ~ 3246873 (+)
CI01000051_02060996_02061735 NA other upstream 3959650 2060534 ~ 2062355 (+)
CI01000051_00638200_00720543 CDC42BPB other upstream 5301029 637590 ~ 720669 (+)
CI01000051_06825895_06830637 NA other downstream 799845 6825895 ~ 6830637 (+)
G221319 NA other downstream 1316087 7342041 ~ 7342546 (+)
G221386 NA other downstream 1383569 7401175 ~ 7413007 (+)
CI01000051_08211233_08214513 NA other downstream 2079689 8209722 ~ 8214696 (+)
G222727 NA other downstream 2316988 8342942 ~ 8343448 (+)

Expression


Co-expression Network