G222194


Basic Information

Item Value
gene id G222194
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 7014105 ~ 7014311 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU251998
CTTGTACTCCAATTATATCAGATCAAAAGCATATGATATGTACATTTTCTATAAGATTTGAGTGCCTTGGACCATCCTTAATTGCATATGATATGTATTTCTTGAAACGTTATGAACAGCAGCTACACTAATTATTTTTCCTTTGGTTTCTGTTTCTTACTCGGGATGCCCATCTAGAGAGTACGCCAGCTCCAGTTTGGATCCACC

Function

NR:

description
uncharacterized protein LOC110522724

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU251998 True 207 lncRNA 0.37 1 7014105 7014311

Neighbor

gene id symbol gene type direction distance location
CI01000051_06966165_06969998 NA coding downstream 43888 6966093 ~ 6970217 (-)
CI01000051_06958650_06963551 CLEC11A coding downstream 50284 6958572 ~ 6963821 (-)
CI01000051_06910132_06916487 NA coding downstream 97618 6909440 ~ 6916487 (-)
CI01000051_06884323_06886377 EXOC8 coding downstream 127466 6884008 ~ 6886639 (-)
CI01000051_06837978_06881158 TRIM67 coding downstream 132399 6837414 ~ 6881706 (-)
CI01000051_07218226_07226180 CHRNA4B coding upstream 203831 7218142 ~ 7226726 (-)
CI01000051_07288569_07296096 ELOVL1B coding upstream 273774 7288085 ~ 7296096 (-)
CI01000051_07403086_07404051 NA coding upstream 387756 7402067 ~ 7404784 (-)
CI01000051_07410144_07439528 MAST3, MAST3B coding upstream 395152 7409463 ~ 7439528 (-)
CI01000051_07580256_07582183 NA coding upstream 565930 7580241 ~ 7582183 (-)
G222190 NA non-coding downstream 2792 7011033 ~ 7011313 (-)
G222173 NA non-coding downstream 19109 6973082 ~ 6994996 (-)
G222137 NA non-coding downstream 250685 6763190 ~ 6763420 (-)
CI01000051_06739181_06742303 PLVAP, VSG1 non-coding downstream 259837 6738639 ~ 6742303 (-)
G222054 NA non-coding downstream 324200 6663608 ~ 6689905 (-)
G222195 NA non-coding upstream 2648 7016959 ~ 7051677 (-)
G222243 NA non-coding upstream 97303 7111614 ~ 7112897 (-)
G222295 NA non-coding upstream 147742 7162053 ~ 7172871 (-)
G222353 NA non-coding upstream 279996 7294307 ~ 7295633 (-)
G222355 NA non-coding upstream 317987 7332298 ~ 7332515 (-)
G221840 NA other downstream 880526 6132773 ~ 6133579 (-)
G221575 NA other downstream 1495281 5513952 ~ 5518824 (-)
G220041 NA other downstream 2856002 4155730 ~ 4158103 (-)
CI01000051_02955633_02960400 SCRN2 other downstream 4052611 2955380 ~ 2961148 (-)
G218861 NA other downstream 4173473 2840270 ~ 2840632 (-)
G222729 NA other upstream 1327838 8342149 ~ 8342652 (-)
G222730 NA other upstream 1328659 8342970 ~ 8343438 (-)

Expression


Co-expression Network