G221353


Basic Information

Item Value
gene id G221353
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 7224890 ~ 7225167 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU251073
CATTTTTAAAACAGATTATAACATCGTTCACTGCCTCAAGCATTATAGTTGATTGACAGATGTCTATACATTTTTGTAAAATCAAGATGCTGCACTGGAGTGGATCTGAGACTCACCACATCAATGAGCTGAGCAATGGACAGGCCAAAGTGGACCAGAACCACATCTGAGATGTTTGCTACAGGACGAGAGAGCTTGTTGTAGTTGCTGAACAAAGACCGGAGGAGTCTTTCTTCCGCATGGGCACGAGCCGGACTGGTGGAAAACACTGCCGAGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU251073 True 278 lncRNA 0.45 1 7224890 7225167

Neighbor

gene id symbol gene type direction distance location
CI01000051_07215332_07217167 NA coding upstream 7182 7215332 ~ 7217708 (+)
CI01000051_07170752_07194524 NA coding upstream 30366 7170752 ~ 7194524 (+)
CI01000051_07125875_07127476 CLDN20 coding upstream 97043 7125875 ~ 7127847 (+)
CI01000051_07081085_07109551 TIAM2 coding upstream 115284 7081085 ~ 7109606 (+)
CI01000051_07015896_07020569 NA coding upstream 204276 7015383 ~ 7020614 (+)
CI01000051_07253002_07255432 PTGFR coding downstream 27034 7252201 ~ 7255620 (+)
CI01000051_07259968_07261598 BT3L4, BTF3L4 coding downstream 34551 7259718 ~ 7261731 (+)
CI01000051_07267084_07283654 ZFYVE9B coding downstream 41844 7267011 ~ 7284015 (+)
CI01000051_07287140_07287867 NA coding downstream 61973 7287140 ~ 7288035 (+)
CI01000051_07337005_07340657 MOB3C, MOB3C.S, MOBKL2C coding downstream 111686 7336853 ~ 7340692 (+)
G221351 NA non-coding upstream 1903 7222717 ~ 7222987 (+)
G221283 NA non-coding upstream 17317 7207371 ~ 7207573 (+)
G221280 NA non-coding upstream 63523 7161166 ~ 7161367 (+)
G221256 NA non-coding upstream 72795 7043663 ~ 7152095 (+)
G221360 NA non-coding downstream 23003 7248170 ~ 7248498 (+)
G221316 NA non-coding downstream 59820 7284987 ~ 7285294 (+)
G221365 NA non-coding downstream 60329 7285496 ~ 7285769 (+)
G221347 NA non-coding downstream 61220 7286387 ~ 7286655 (+)
G221311 NA non-coding downstream 67072 7292239 ~ 7293753 (+)
CI01000051_06825895_06830637 NA other upstream 391822 6825895 ~ 6830637 (+)
G219803 NA other upstream 2172857 4914974 ~ 5052033 (+)
CI01000051_04374052_04393328 NA other upstream 2849560 4372658 ~ 4393677 (+)
G218981 NA other upstream 3978017 3245443 ~ 3246873 (+)
CI01000051_02060996_02061735 NA other upstream 5158807 2060534 ~ 2062355 (+)
G221319 NA other downstream 116874 7342041 ~ 7342546 (+)
G221386 NA other downstream 184356 7401175 ~ 7413007 (+)
CI01000051_08211233_08214513 NA other downstream 880476 8209722 ~ 8214696 (+)
G222727 NA other downstream 1117775 8342942 ~ 8343448 (+)

Expression


Co-expression Network