G222356


Basic Information

Item Value
gene id G222356
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 7342108 ~ 7342528 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU252193
GCATCTCTGGAGCTCAGCCACAGTGATCTTTGGGTTCTTCTTTACCTCTCTCACCAAGGCTCTTCTCCCCCGATAGCTCAGTTTGGCCGGACGGCCAGCTCTAGGAAGGGTTCTGGTCGTCCCAAACATCTTCCATTTAAGGATTATGGAGGCCACTGTGCTCTTAGGAACCTTAAGTGCAGCAGAAATTTTTTTGTAACCTTGGCCAGATCTGTGCCTTGCCACAATTCTGTCTCTGAGCTCTTCAGGCAGTTCCTTTGACCTCATGATTCTCATTTGCTCTGACATGCACTGTGAGCTGTAAGATCTTATATAGACAGGTGTGTGGCTTTCCTAATCAAGTCCAATCAGTATAATCAAACACAGCTGGACTCAAATGAAGGTGTAGAACCATCTCAAGGATGATCAGAAGAAATGGACA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU252193 True 421 lncRNA 0.46 1 7342108 7342528

Neighbor

gene id symbol gene type direction distance location
CI01000051_07288569_07296096 ELOVL1B coding downstream 46012 7288085 ~ 7296096 (-)
CI01000051_07218226_07226180 CHRNA4B coding downstream 115382 7218142 ~ 7226726 (-)
CI01000051_06966165_06969998 NA coding downstream 371891 6966093 ~ 6970217 (-)
CI01000051_06958650_06963551 CLEC11A coding downstream 378287 6958572 ~ 6963821 (-)
CI01000051_06910132_06916487 NA coding downstream 425621 6909440 ~ 6916487 (-)
CI01000051_07403086_07404051 NA coding upstream 59539 7402067 ~ 7404784 (-)
CI01000051_07410144_07439528 MAST3, MAST3B coding upstream 66935 7409463 ~ 7439528 (-)
CI01000051_07580256_07582183 NA coding upstream 237713 7580241 ~ 7582183 (-)
CI01000051_07584669_07585335 NA coding upstream 241827 7584355 ~ 7585335 (-)
CI01000051_07618053_07621854 NA coding upstream 275514 7618042 ~ 7621854 (-)
G222355 NA non-coding downstream 9593 7332298 ~ 7332515 (-)
G222353 NA non-coding downstream 46475 7294307 ~ 7295633 (-)
G222295 NA non-coding downstream 169237 7162053 ~ 7172871 (-)
G222243 NA non-coding downstream 229211 7111614 ~ 7112897 (-)
G222195 NA non-coding downstream 290431 7016959 ~ 7051677 (-)
G222361 NA non-coding upstream 13575 7356103 ~ 7356312 (-)
G222363 NA non-coding upstream 14621 7357149 ~ 7357385 (-)
G222262 NA non-coding upstream 24364 7366892 ~ 7371000 (-)
G222370 NA non-coding upstream 33190 7375718 ~ 7375990 (-)
G222378 NA non-coding upstream 115714 7458242 ~ 7458443 (-)
G221840 NA other downstream 1208529 6132773 ~ 6133579 (-)
G221575 NA other downstream 1823284 5513952 ~ 5518824 (-)
G220041 NA other downstream 3184005 4155730 ~ 4158103 (-)
CI01000051_02955633_02960400 SCRN2 other downstream 4380614 2955380 ~ 2961148 (-)
G218861 NA other downstream 4501476 2840270 ~ 2840632 (-)
G222729 NA other upstream 999621 8342149 ~ 8342652 (-)
G222730 NA other upstream 1000442 8342970 ~ 8343438 (-)

Expression


Co-expression Network