G222363



Basic Information


Item Value
gene id G222363
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 7357149 ~ 7357385 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU252200
TGAATGGCTGTGGTGTCCTGTAGAGTGGGCTCGCTGGTCTCCATCTCAAACACAGCTCTGCCCATCCTCATCAATGGCCAGCGGTCCCGTCCGGCAGATGTGCGAGAAGTTTGTCTGATGGGTCGGCGACTGCAGATGCAACACGCTCCAAAAAATGAAAAGGCCACCAAGAGGAGGATGGGTCCGATGATGATGGGAGGGTTGTTTAAGGGGAGGAGTTTAGTAAAGGCAAGCGCG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU252200 True 237 lncRNA 0.55 1 7357149 7357385

Neighbor


gene id symbol gene type direction distance location
CI01000051_07288569_07296096 ELOVL1B coding downstream 61053 7288085 ~ 7296096 (-)
CI01000051_07218226_07226180 CHRNA4B coding downstream 130423 7218142 ~ 7226726 (-)
CI01000051_06966165_06969998 NA coding downstream 386932 6966093 ~ 6970217 (-)
CI01000051_06958650_06963551 CLEC11A coding downstream 393328 6958572 ~ 6963821 (-)
CI01000051_06910132_06916487 NA coding downstream 440662 6909440 ~ 6916487 (-)
CI01000051_07403086_07404051 NA coding upstream 44682 7402067 ~ 7404784 (-)
CI01000051_07410144_07439528 MAST3, MAST3B coding upstream 52078 7409463 ~ 7439528 (-)
CI01000051_07580256_07582183 NA coding upstream 222856 7580241 ~ 7582183 (-)
CI01000051_07584669_07585335 NA coding upstream 226970 7584355 ~ 7585335 (-)
CI01000051_07618053_07621854 NA coding upstream 260657 7618042 ~ 7621854 (-)
G222361 NA non-coding downstream 837 7356103 ~ 7356312 (-)
G222356 NA non-coding downstream 14621 7342108 ~ 7342528 (-)
G222355 NA non-coding downstream 24634 7332298 ~ 7332515 (-)
G222353 NA non-coding downstream 61516 7294307 ~ 7295633 (-)
G222295 NA non-coding downstream 184278 7162053 ~ 7172871 (-)
G222262 NA non-coding upstream 9507 7366892 ~ 7371000 (-)
G222370 NA non-coding upstream 18333 7375718 ~ 7375990 (-)
G222378 NA non-coding upstream 100857 7458242 ~ 7458443 (-)
G222379 NA non-coding upstream 101717 7459102 ~ 7461790 (-)
G222386 NA non-coding upstream 110046 7467431 ~ 7785815 (-)
G221840 NA other downstream 1223570 6132773 ~ 6133579 (-)
G221575 NA other downstream 1838325 5513952 ~ 5518824 (-)
G220041 NA other downstream 3199046 4155730 ~ 4158103 (-)
CI01000051_02955633_02960400 SCRN2 other downstream 4395655 2955380 ~ 2961148 (-)
G218861 NA other downstream 4516517 2840270 ~ 2840632 (-)
G222729 NA other upstream 984764 8342149 ~ 8342652 (-)
G222730 NA other upstream 985585 8342970 ~ 8343438 (-)

Expression



Co-expression Network