G222378



Basic Information


Item Value
gene id G222378
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 7458242 ~ 7458443 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU252215
GTTTTGTTTTGTCTGTTCTCTGAGATCTCTGCTTAGTCTGTCTTTATGTTTCTTAAGTGTCGGTTCTTGGTCAACTATGCTGGTTTCTGTCAAATGATTAGTGCAATTTGGTTTCACTTCTTATAGGTGTGCTTGTGGGTGAGGTGAATAGGAAGGCTTCAATTCAACCACACTCTGCGGCCACTATTACAGTGATATCAAC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU252215 True 202 lncRNA 0.41 1 7458242 7458443

Neighbor


gene id symbol gene type direction distance location
CI01000051_07410144_07439528 MAST3, MAST3B coding downstream 18714 7409463 ~ 7439528 (-)
CI01000051_07403086_07404051 NA coding downstream 53458 7402067 ~ 7404784 (-)
CI01000051_07288569_07296096 ELOVL1B coding downstream 162146 7288085 ~ 7296096 (-)
CI01000051_07218226_07226180 CHRNA4B coding downstream 231516 7218142 ~ 7226726 (-)
CI01000051_06966165_06969998 NA coding downstream 488025 6966093 ~ 6970217 (-)
CI01000051_07580256_07582183 NA coding upstream 121798 7580241 ~ 7582183 (-)
CI01000051_07584669_07585335 NA coding upstream 125912 7584355 ~ 7585335 (-)
CI01000051_07618053_07621854 NA coding upstream 159599 7618042 ~ 7621854 (-)
CI01000051_07836858_07853522 TMEM259 coding upstream 378382 7836825 ~ 7854111 (-)
CI01000051_08087374_08111384 NA coding upstream 628495 8086938 ~ 8111595 (-)
G222370 NA non-coding downstream 82252 7375718 ~ 7375990 (-)
G222262 NA non-coding downstream 87242 7366892 ~ 7371000 (-)
G222363 NA non-coding downstream 100857 7357149 ~ 7357385 (-)
G222361 NA non-coding downstream 101930 7356103 ~ 7356312 (-)
G222356 NA non-coding downstream 115714 7342108 ~ 7342528 (-)
G222379 NA non-coding upstream 659 7459102 ~ 7461790 (-)
G222386 NA non-coding upstream 8988 7467431 ~ 7785815 (-)
G222383 NA non-coding upstream 10116 7468559 ~ 7506222 (-)
G222287 NA non-coding upstream 331935 7790378 ~ 7844010 (-)
G222289 NA non-coding upstream 361159 7819602 ~ 7867243 (-)
G221840 NA other downstream 1324663 6132773 ~ 6133579 (-)
G221575 NA other downstream 1939418 5513952 ~ 5518824 (-)
G220041 NA other downstream 3300139 4155730 ~ 4158103 (-)
CI01000051_02955633_02960400 SCRN2 other downstream 4496748 2955380 ~ 2961148 (-)
G218861 NA other downstream 4617610 2840270 ~ 2840632 (-)
G222729 NA other upstream 883706 8342149 ~ 8342652 (-)
G222730 NA other upstream 884527 8342970 ~ 8343438 (-)

Expression



Co-expression Network