G222502


Basic Information

Item Value
gene id G222502
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 7880640 ~ 7880840 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU252366
TGAGCATTAATAAATTATAAGGTGGTCACATTCATCTTTTTCCAGCGAAATTCCACAGGTGAAATGTGAAACTTTTAATGCAAATTTACTACAAATGTTAGTAAACTTCATGCATCGCTACATTATTGACAATGGACCTACTTAACCCGTAAAATTTTGCAGAGGTTTTGTGGCCATACCTTTACATGTGTCACGATCACC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU252366 True 201 lncRNA 0.35 1 7880640 7880840

Neighbor

gene id symbol gene type direction distance location
CI01000051_07836858_07853522 TMEM259 coding downstream 26529 7836825 ~ 7854111 (-)
CI01000051_07618053_07621854 NA coding downstream 258786 7618042 ~ 7621854 (-)
CI01000051_07584669_07585335 NA coding downstream 295305 7584355 ~ 7585335 (-)
CI01000051_07580256_07582183 NA coding downstream 298457 7580241 ~ 7582183 (-)
CI01000051_07410144_07439528 MAST3, MAST3B coding downstream 441112 7409463 ~ 7439528 (-)
CI01000051_08087374_08111384 NA coding upstream 206098 8086938 ~ 8111595 (-)
CI01000051_08247858_08254018 NA coding upstream 366803 8247643 ~ 8254266 (-)
CI01000051_08346268_08346909 NA coding upstream 465306 8346146 ~ 8347058 (-)
CI01000051_08354973_08355986 NA coding upstream 474085 8354925 ~ 8356034 (-)
CI01000051_08401449_08401739 NA coding upstream 520373 8401213 ~ 8401786 (-)
G222289 NA non-coding downstream 13397 7819602 ~ 7867243 (-)
G222287 NA non-coding downstream 36630 7790378 ~ 7844010 (-)
G222386 NA non-coding downstream 94825 7467431 ~ 7785815 (-)
G222383 NA non-coding downstream 374418 7468559 ~ 7506222 (-)
G222379 NA non-coding downstream 418850 7459102 ~ 7461790 (-)
G222519 NA non-coding upstream 78265 7959105 ~ 7959341 (-)
G222524 NA non-coding upstream 118602 7999442 ~ 7999673 (-)
G222526 NA non-coding upstream 127071 8007911 ~ 8008161 (-)
G222625 NA non-coding upstream 336035 8216875 ~ 8217121 (-)
G222626 NA non-coding upstream 337450 8218290 ~ 8218525 (-)
G221840 NA other downstream 1747061 6132773 ~ 6133579 (-)
G221575 NA other downstream 2361816 5513952 ~ 5518824 (-)
G220041 NA other downstream 3722537 4155730 ~ 4158103 (-)
CI01000051_02955633_02960400 SCRN2 other downstream 4919146 2955380 ~ 2961148 (-)
G218861 NA other downstream 5040008 2840270 ~ 2840632 (-)
G222729 NA other upstream 461309 8342149 ~ 8342652 (-)
G222730 NA other upstream 462130 8342970 ~ 8343438 (-)

Expression


Co-expression Network