G221552


Basic Information

Item Value
gene id G221552
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000051
NCBI id null
chromosome length 8436717
location 8041617 ~ 8041854 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU251290
AGAAGATGGAAAGGACACTATTACACAGGGCTCGACATTAACGCTTGTCCGGGACAAATGGATATCTTGAAGGGGTAGTTCCAAACAAAGATCACAACAGAACCATAGCGCATCTCACAGCGACACTCAACTGTGTTTTTATTAGCTAACGAATGAATCAGTGTTTTGAACGAATCGGTTGAGTCAAAGATTCAATGACCCATTCATAAGCAACTGCCTCATTCTTGATTGAATCAGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU251290 True 238 lncRNA 0.42 1 8041617 8041854

Neighbor

gene id symbol gene type direction distance location
CI01000051_07978982_07979269 NA coding upstream 62314 7978390 ~ 7979303 (+)
CI01000051_07963621_07976671 PTBP1B, PTBP1 coding upstream 63408 7963621 ~ 7978209 (+)
CI01000051_07954270_07957397 NA coding upstream 84058 7954270 ~ 7957559 (+)
CI01000051_07946087_07950464 NA coding upstream 90136 7946016 ~ 7951481 (+)
CI01000051_07938052_07941645 MISP coding upstream 99506 7937692 ~ 7942111 (+)
CI01000051_08046197_08069874 NA coding downstream 4041 8045895 ~ 8069917 (+)
CI01000051_08171018_08172280 EFNA2 coding downstream 129164 8171018 ~ 8172544 (+)
CI01000051_08211233_08214513 NA coding downstream 167868 8209722 ~ 8214696 (+)
CI01000051_08381644_08388611 NA coding downstream 339737 8381591 ~ 8389116 (+)
CI01000051_08425890_08429863 NA coding downstream 382843 8424697 ~ 8429965 (+)
G221539 NA non-coding upstream 25082 8016244 ~ 8016535 (+)
G221538 NA non-coding upstream 32266 8008915 ~ 8009351 (+)
G221530 NA non-coding upstream 45320 7996022 ~ 7996297 (+)
CI01000051_07806350_07831779 GRIN3B non-coding upstream 174589 7806350 ~ 7832334 (+)
G221333 NA non-coding upstream 200843 7804351 ~ 7840774 (+)
G222631 NA non-coding downstream 182096 8223950 ~ 8224280 (+)
G222642 NA non-coding downstream 190812 8232666 ~ 8232884 (+)
G222645 NA non-coding downstream 191616 8233470 ~ 8234002 (+)
G222653 NA non-coding downstream 201510 8243364 ~ 8243605 (+)
G222656 NA non-coding downstream 204686 8246540 ~ 8246748 (+)
G221386 NA other upstream 628610 7401175 ~ 7413007 (+)
G221319 NA other upstream 699071 7342041 ~ 7342546 (+)
CI01000051_06825895_06830637 NA other upstream 1208549 6825895 ~ 6830637 (+)
G219803 NA other upstream 2989584 4914974 ~ 5052033 (+)
CI01000051_04374052_04393328 NA other upstream 3666287 4372658 ~ 4393677 (+)
G222727 NA other downstream 301088 8342942 ~ 8343448 (+)

Expression


Co-expression Network