G223990



Basic Information


Item Value
gene id G223990
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000052
NCBI id null
chromosome length 3494004
location 2820468 ~ 2820698 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU254063
GTAATTAATGACAGAATAAATTACATTTTTGGGTGAACTAACCCTTTAAGTATTTAATGTGAAATACAAAATAGTATTTCTTCTTCTTCTTCTAATAATAATAACAGTACAAATTATTATTATTATTTAGTGCTGTCAAATCAATTAATCATGATTAATCACAACATCGATTTGACAGCGCTATTTTTATTATATAATTGTGACAAATTCATAGACCGCATCCGTCATTGC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU254063 True 231 lncRNA 0.26 1 2820468 2820698

Neighbor


gene id symbol gene type direction distance location
CI01000052_02646977_02647792 NA coding upstream 172644 2646223 ~ 2647824 (+)
CI01000052_02622010_02627854 NA coding upstream 192158 2620241 ~ 2628310 (+)
CI01000052_02597704_02601005 NA coding upstream 218616 2597556 ~ 2601852 (+)
CI01000052_02591303_02592790 NA coding upstream 227671 2588859 ~ 2592797 (+)
CI01000052_02468269_02501109 HMCN2 coding upstream 319294 2468269 ~ 2501174 (+)
CI01000052_02845585_02849894 NA coding downstream 24852 2845550 ~ 2849978 (+)
CI01000052_02850485_02858740 NA coding downstream 29657 2850355 ~ 2858861 (+)
CI01000052_03401048_03405703 NA coding downstream 579572 3400270 ~ 3406312 (+)
CI01000052_03453140_03462799 NA coding downstream 632254 3452952 ~ 3462799 (+)
CI01000052_03484560_03485959 NA coding downstream 663862 3484560 ~ 3486253 (+)
G223986 NA non-coding upstream 5160 2815081 ~ 2815308 (+)
G223866 NA non-coding upstream 294694 2520202 ~ 2525774 (+)
G223865 NA non-coding upstream 300827 2519404 ~ 2519641 (+)
G223864 NA non-coding upstream 302461 2517478 ~ 2518007 (+)
G223995 NA non-coding downstream 3842 2824540 ~ 2824758 (+)
G223996 NA non-coding downstream 5324 2826022 ~ 2826270 (+)
G224000 NA non-coding downstream 9644 2830342 ~ 2830547 (+)
G224005 NA non-coding downstream 38423 2859121 ~ 2859352 (+)
G224606 NA non-coding downstream 98784 2919482 ~ 2919722 (+)
G223694 NA other upstream 716169 2049326 ~ 2104299 (+)
G223545 NA other upstream 1549541 1270492 ~ 1270927 (+)
G224953 NA other downstream 610438 3431136 ~ 3460136 (+)

Expression



Co-expression Network