CI01000053_00815725_00817893 (LIM2.1, LIM2.3)



Basic Information


Item Value
gene id CI01000053_00815725_00817893
gene name LIM2.1, LIM2.3
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 815597 ~ 817893 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>CI01000053_00815725_00817893.mRNA
GTGCAAGATGTACAGCTTTATGGGAGGTGGATTGTTCTGTGCAGGAGTAGGGAACATACTCCTGGTGATCTCCACTGCCACCGATTACTGGATGCAGTACCGCCAGTCCAGCAGTTTCACGCATATGGGCCTGTGGCGCTACTGTGTACCTGGAAAATGCATAATGCACACAGACAGCATCGCATACTGGGATGCCACCCGGGCCTTCATGATCCTGTCCGTCATAGCTTGCTTCTTTGGCATCATCATCGGTGTCATGGCTTTCATCAATTACTCCTCCTTTAGCGGATTCGACAAAACCTTTGCTGCAGGAATTCTCTATTTCATTTCATGCTTCTTTGTGCTGCTGGCCATGGCTGTCTACACTGGCGTGACAGTCAACTACTATGGAAAACGTTATGGGAAATGGCGGTTCTCTTGGTCGTACATAATGGGCTGGGTTTCTGTGGTGCTCACATTCTTTTCAGGGATCTTCTATATGTGCGCTTACCGGATGCAAGAACCAAGAGGCCCAATGTCACGCTGATGCTTCTCATCCTAGATCTGCTATTCGATCCCTTCAGTCTGAATGTGAACCATCATCATCCCTGATCCCTTCATTTTAGACCTGTCATTTATTGTTTATTTTAAAATCACAGAACACAAACTAATAAA

Function


symbol description
lim2.3 Predicted to be a structural constituent of eye lens. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in plasma membrane. Is expressed in lens and solid lens vesicle. Human ortholog(s) of this gene implicated in cataract and cataract 19 multiple types. Orthologous to human LIM2 (lens intrinsic membrane protein 2).
lim2.1 Predicted to be a structural constituent of eye lens. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in plasma membrane. Is expressed in lens and solid lens vesicle. Human ortholog(s) of this gene implicated in cataract and cataract 19 multiple types. Orthologous to human LIM2 (lens intrinsic membrane protein 2).

NR:

description
lens membrane protein mp19-1

GO:

id name namespace
GO:0016021 integral component of membrane cellular_component

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
CI01000053_00815725_00817893.mRNA True 654 mRNA 0.46 4 815597 817893

Neighbor


gene id symbol gene type direction distance location
CI01000053_00797990_00802827 NA coding downstream 12537 797707 ~ 803060 (-)
CI01000053_00739813_00746803 NA coding downstream 68566 739662 ~ 747031 (-)
CI01000053_00733357_00737206 NA coding downstream 78270 733315 ~ 737327 (-)
CI01000053_00696659_00703507 NA coding downstream 112090 696362 ~ 703507 (-)
CI01000053_00678066_00685960 DYRK1A coding downstream 127791 677932 ~ 687806 (-)
CI01000053_00830433_00864331 NA coding upstream 12305 830198 ~ 864373 (-)
CI01000053_00865420_00881846 ROBO3, ROBO2 coding upstream 47480 865373 ~ 881846 (-)
CI01000053_00956174_00961278 ACAD8 coding upstream 138116 956009 ~ 961278 (-)
CI01000053_00968102_00970741 VPS26BL, V26BL, V26BB, VPS26B coding upstream 150150 968043 ~ 971775 (-)
CI01000053_00974193_00978185 JAM3A coding upstream 155368 973261 ~ 978185 (-)
G225561 NA non-coding downstream 1357 813628 ~ 814240 (-)
G225563 NA non-coding downstream 5863 808167 ~ 809734 (-)
G225668 NA non-coding downstream 66102 749251 ~ 749495 (-)
G225665 NA non-coding downstream 67978 747381 ~ 747619 (-)
G225622 NA non-coding downstream 244340 571056 ~ 571257 (-)
G225687 NA non-coding upstream 88667 906560 ~ 907001 (-)
G225690 NA non-coding upstream 120692 938585 ~ 938904 (-)
G225691 NA non-coding upstream 121103 938996 ~ 939349 (-)
G225692 NA non-coding upstream 122688 940581 ~ 940782 (-)
G225577 NA non-coding upstream 136910 954803 ~ 955238 (-)
G225574 NA other downstream 268729 543647 ~ 546868 (-)
G225812 NA other upstream 641702 1459595 ~ 1466732 (-)
CI01000053_02225226_02226481 YPELD, YPEL2B, YPEL1, YPELC, YPEL2 other upstream 1399555 2225210 ~ 2226481 (-)
G226826 NA other upstream 1747999 2565892 ~ 2567072 (-)
G226963 NA other upstream 2178824 2996717 ~ 2997268 (-)
CI01000053_03551506_03551965 NA other upstream 2732440 3550333 ~ 3552847 (-)

Expression



Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location