G225687


Basic Information

Item Value
gene id G225687
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 906560 ~ 907001 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU256012
ACCTGGAAACACCCACAGTAAGGTGAGAAGCAGAAATGTTGGAGGTCTCCAGTCCATCAGCCTCTCCATCGCCCCTCACAAAGCGCCCGCTCGCGCGATACCTCATATAGCATCTAGTGATAGTCACTCTCGCGCTCTTATTCTGCCCCGAGCTGTCTTCTGCCTTCCCTCGGTCGTTAAAATTTATATTTTGTTTGAGTATATCAATTCATTCAACCCCGACAGAAGAACCCGAGTCAAGCTTGTAAATGTCCTCCTCTTCTCTCATCCGCGCAGCGGACGGCACTTGGAGAAGGGCTCTTTGTAAAGCTTCTGCGCTTCTTTCTTTAAAATAAACTCTCTGTGGATAGTCAGTCAAGTATTTTCATTCATAACTGAAGTTTTTAGTAGTTCTTGGACGGTACGAAGCGCGTCTGTGACCTGAGCGCGATTCCACTACCAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU256012 True 442 lncRNA 0.48 1 906560 907001

Neighbor

gene id symbol gene type direction distance location
CI01000053_00865420_00881846 ROBO3, ROBO2 coding downstream 24714 865373 ~ 881846 (-)
CI01000053_00830433_00864331 NA coding downstream 42187 830198 ~ 864373 (-)
CI01000053_00815725_00817893 LIM2.1, LIM2.3 coding downstream 88667 815597 ~ 817893 (-)
CI01000053_00797990_00802827 NA coding downstream 103500 797707 ~ 803060 (-)
CI01000053_00739813_00746803 NA coding downstream 159529 739662 ~ 747031 (-)
CI01000053_00956174_00961278 ACAD8 coding upstream 49008 956009 ~ 961278 (-)
CI01000053_00968102_00970741 VPS26BL, V26BL, V26BB, VPS26B coding upstream 61042 968043 ~ 971775 (-)
CI01000053_00974193_00978185 JAM3A coding upstream 66260 973261 ~ 978185 (-)
CI01000053_01063383_01064712 NA coding upstream 156228 1061690 ~ 1066035 (-)
CI01000053_01124489_01129327 NA coding upstream 216758 1123759 ~ 1129359 (-)
G225678 NA non-coding downstream 89892 816404 ~ 816668 (-)
G225561 NA non-coding downstream 92320 813628 ~ 814240 (-)
G225563 NA non-coding downstream 96826 808167 ~ 809734 (-)
G225668 NA non-coding downstream 157065 749251 ~ 749495 (-)
G225665 NA non-coding downstream 158941 747381 ~ 747619 (-)
G225690 NA non-coding upstream 31584 938585 ~ 938904 (-)
G225691 NA non-coding upstream 31995 938996 ~ 939349 (-)
G225692 NA non-coding upstream 33580 940581 ~ 940782 (-)
G225577 NA non-coding upstream 47802 954803 ~ 955238 (-)
G225581 NA non-coding upstream 48389 955390 ~ 955663 (-)
G225574 NA other downstream 359692 543647 ~ 546868 (-)
G225812 NA other upstream 552594 1459595 ~ 1466732 (-)
CI01000053_02225226_02226481 YPELD, YPEL2B, YPEL1, YPELC, YPEL2 other upstream 1310447 2225210 ~ 2226481 (-)
G226826 NA other upstream 1658891 2565892 ~ 2567072 (-)
G226963 NA other upstream 2089716 2996717 ~ 2997268 (-)
CI01000053_03551506_03551965 NA other upstream 2643332 3550333 ~ 3552847 (-)

Expression


Co-expression Network