G225884


Basic Information

Item Value
gene id G225884
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 1543528 ~ 1543742 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU256233
GCAGTCTGTGTTCTTCTGACTTTATTTTGTAGTAAGTAACGAAAATGCTTTGGGAAAATGTATCGGAGTAAAAGTATACATTTTATTTAGGAAATGTAGTGGAGTAAAAGTAAAAGTTGACAGAAATATAAAAACTCAAGTAAAGTACAGATTCTCCCAAAAAATACTTAAGTACTGTAACGAAGTATTATTACTTTGTTACATTACACCACTGC

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU256233 True 215 lncRNA 0.30 1 1543528 1543742

Neighbor

gene id symbol gene type direction distance location
CI01000053_01166907_01193322 CADM1B coding downstream 350206 1166476 ~ 1193322 (-)
CI01000053_01124489_01129327 NA coding downstream 414169 1123759 ~ 1129359 (-)
CI01000053_01063383_01064712 NA coding downstream 477812 1061690 ~ 1066035 (-)
CI01000053_00974193_00978185 JAM3A coding downstream 565343 973261 ~ 978185 (-)
CI01000053_00968102_00970741 VPS26BL, V26BL, V26BB, VPS26B coding downstream 571753 968043 ~ 971775 (-)
CI01000053_01603290_01609575 DIXDC1A, DIXDC1 coding upstream 59186 1602928 ~ 1609575 (-)
CI01000053_01629699_01639689 NA coding upstream 85544 1629286 ~ 1639763 (-)
CI01000053_01655618_01660681 NA coding upstream 111806 1655548 ~ 1660737 (-)
CI01000053_01720326_01736077 NA coding upstream 176556 1720298 ~ 1736077 (-)
CI01000053_01759982_01765920 NA coding upstream 214943 1758685 ~ 1766084 (-)
G225809 NA non-coding downstream 12526 1529142 ~ 1531002 (-)
G225840 NA non-coding downstream 64306 1411802 ~ 1479222 (-)
G225813 NA non-coding downstream 136275 1359824 ~ 1407253 (-)
G225731 NA non-coding downstream 245476 1269524 ~ 1298052 (-)
G225886 NA non-coding upstream 1109 1544851 ~ 1545187 (-)
G225888 NA non-coding upstream 5765 1549507 ~ 1549859 (-)
G226513 NA non-coding upstream 76194 1619936 ~ 1622818 (-)
G226606 NA non-coding upstream 198718 1742460 ~ 1742765 (-)
G226609 NA non-coding upstream 204138 1747880 ~ 1748087 (-)
G225812 NA other downstream 76796 1459595 ~ 1466732 (-)
G225574 NA other downstream 996660 543647 ~ 546868 (-)
CI01000053_02225226_02226481 YPELD, YPEL2B, YPEL1, YPELC, YPEL2 other upstream 673706 2225210 ~ 2226481 (-)
G226826 NA other upstream 1022150 2565892 ~ 2567072 (-)
G226963 NA other upstream 1452975 2996717 ~ 2997268 (-)
CI01000053_03551506_03551965 NA other upstream 2006591 3550333 ~ 3552847 (-)
G227604 NA other upstream 2543495 4087237 ~ 4087740 (-)

Expression


Co-expression Network