G225957


Basic Information

Item Value
gene id G225957
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 1889931 ~ 1890162 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU256362
TAACTCAATGGTTTTAGTTCTCAGATTTGGCTCCCTTGTTCTGGAAACCAAAGTGTTTCTGTTTAGATGCCGTATATACAGTGTATCTTTAGGCATATTTGTACCTAGTAAGTTAATTTTAACCTTCAATATTATAGTAAAGTAGTACCAGCTAACTCCCATGTGTAGTTTACAGCATTAGTTGAGAGATATACTGATATACTACATCCAAAATAATCGATATCGAATCGAA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU256362 True 232 lncRNA 0.33 1 1889931 1890162

Neighbor

gene id symbol gene type direction distance location
CI01000053_01860130_01870321 NA coding upstream 19495 1859970 ~ 1870436 (+)
CI01000053_01790197_01796045 POU2AF1 coding upstream 92474 1789189 ~ 1797457 (+)
CI01000053_01751833_01753354 ATF5B coding upstream 136480 1751833 ~ 1753451 (+)
CI01000053_01663005_01713138 PHLDB1 coding upstream 176734 1661039 ~ 1713197 (+)
CI01000053_01649924_01653347 NA coding upstream 236390 1649924 ~ 1654260 (+)
CI01000053_01972623_01978167 TUBD1 coding downstream 82461 1972623 ~ 1978639 (+)
CI01000053_02071290_02083892 NA coding downstream 181128 2071290 ~ 2084045 (+)
CI01000053_02086227_02097758 CUL5, CUL5A, CUL5.L coding downstream 195119 2085281 ~ 2097947 (+)
CI01000053_02103844_02105757 MRPL28 coding downstream 213392 2103554 ~ 2105895 (+)
CI01000053_02118918_02119910 MOS coding downstream 228667 2118829 ~ 2120222 (+)
G225956 NA non-coding upstream 2747 1886983 ~ 1887184 (+)
G225948 NA non-coding upstream 41913 1845716 ~ 1848018 (+)
G225947 NA non-coding upstream 44342 1845376 ~ 1845589 (+)
G225946 NA non-coding upstream 44991 1844646 ~ 1844940 (+)
G225940 NA non-coding upstream 71762 1812634 ~ 1818169 (+)
G225958 NA non-coding downstream 6699 1896861 ~ 1897069 (+)
G225990 NA non-coding downstream 24696 1914858 ~ 1915228 (+)
G225997 NA non-coding downstream 34262 1924424 ~ 1924672 (+)
G225978 NA non-coding downstream 39608 1929770 ~ 1931337 (+)
G225981 NA non-coding downstream 41404 1931566 ~ 1931899 (+)
G225952 NA other upstream 16636 1872874 ~ 1873295 (+)
CI01000053_02594164_02594541 DYNLL6, DYNLL1, DYNLL2A, DYNLL2, BRAFLDRAFT_114344, DYL1, DYNLL1.S, BRAFLDRAFT_130244, DYNLL1.L other downstream 703065 2592558 ~ 2595467 (+)
G226292 NA other downstream 1146440 3036602 ~ 3046783 (+)
G226347 NA other downstream 1382212 3272374 ~ 3274911 (+)
G226399 NA other downstream 1730636 3620798 ~ 3697529 (+)
G227317 NA other downstream 2524789 4414951 ~ 4415593 (+)

Expression


Co-expression Network