G226647


Basic Information

Item Value
gene id G226647
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 2068531 ~ 2068740 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU257175
GTGTTGGTTCCCCTTTTGCTGCCAAAACAGCCCTGAACCGTCGAGGCATGGACTCCGCTAGACCCCTAAAGGTGTGCTTTGGTATCTGGCACCAAGACGTTAGCAGCAGATCCTTTAAGTCCTGTAAGTTGCGAGGTTGTAAGTTGCCTTCATGGATCGGACTTGTTTGTTCAGCACATCCCACAGATTCTCAATGGATTGAGATCGGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU257175 True 210 lncRNA 0.50 1 2068531 2068740

Neighbor

gene id symbol gene type direction distance location
CI01000053_02041737_02066520 NA coding downstream 1873 2041690 ~ 2066658 (-)
CI01000053_02032534_02040859 DHX40 coding downstream 27094 2032380 ~ 2041437 (-)
CI01000053_02029813_02031204 CLTCB, CLTC coding downstream 36741 2029813 ~ 2031790 (-)
CI01000053_02003828_02014352 CLTC coding downstream 54179 2002910 ~ 2014352 (-)
CI01000053_01982526_02001150 VMP1 coding downstream 67381 1982302 ~ 2001150 (-)
CI01000053_02109802_02117454 NA coding upstream 40431 2109171 ~ 2117957 (-)
CI01000053_02122241_02132642 CLPTM1 coding upstream 52889 2121629 ~ 2132787 (-)
CI01000053_02145248_02149126 NA coding upstream 76438 2145178 ~ 2149381 (-)
CI01000053_02225226_02226481 YPELD, YPEL2B, YPEL1, YPELC, YPEL2 coding upstream 156470 2225210 ~ 2226481 (-)
CI01000053_02241056_02246083 GDPD1 coding upstream 171823 2240563 ~ 2246301 (-)
G226645 NA non-coding downstream 4806 2063410 ~ 2063725 (-)
G226542 NA non-coding downstream 136651 1931548 ~ 1931880 (-)
G226553 NA non-coding downstream 137194 1929839 ~ 1931337 (-)
G226614 NA non-coding downstream 291873 1776450 ~ 1776658 (-)
G226649 NA non-coding upstream 14638 2083378 ~ 2083915 (-)
G226543 NA non-coding upstream 34653 2103393 ~ 2104463 (-)
G226657 NA non-coding upstream 37482 2106222 ~ 2106444 (-)
G226658 NA non-coding upstream 37990 2106730 ~ 2107029 (-)
G226660 NA non-coding upstream 69828 2138568 ~ 2138991 (-)
G225812 NA other downstream 601799 1459595 ~ 1466732 (-)
G225574 NA other downstream 1521663 543647 ~ 546868 (-)
G226826 NA other upstream 497152 2565892 ~ 2567072 (-)
G226963 NA other upstream 927977 2996717 ~ 2997268 (-)
CI01000053_03551506_03551965 NA other upstream 1481593 3550333 ~ 3552847 (-)
G227604 NA other upstream 2018497 4087237 ~ 4087740 (-)

Expression


Co-expression Network