G226834



Basic Information


Item Value
gene id G226834
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 2568685 ~ 2568928 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU257367
ATGTGTCCAGTAAACCGGTGTGGGAATTCCGGCAGGAAAATGGAAATAAAGCCCGGCAGTGTCCACTCTAGACGAGGCCCCTCAGGGTTTGCGTTTGAGGGCCGAGATTGCTCAGAGATGGGGTATTCTCTGCACTGGGCCCTGCGTCTAAATGGACTGTGATGAACAAGCGGAGCCGAGAGAGACAGGAAGCCCTGATGACATGACAAGGATCTCCTCTTCACCAGTAATGATGATGATGCCT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU257367 True 244 lncRNA 0.53 1 2568685 2568928

Neighbor


gene id symbol gene type direction distance location
CI01000053_02533620_02536887 NA coding downstream 30845 2533593 ~ 2537840 (-)
CI01000053_02497603_02508436 NA coding downstream 59962 2497590 ~ 2508723 (-)
CI01000053_02486308_02487685 NA coding downstream 80655 2485144 ~ 2488030 (-)
CI01000053_02449164_02455151 NA coding downstream 113534 2449016 ~ 2455151 (-)
CI01000053_02427507_02435639 FLOT2A, FLT2, FLOT2B, FLOT2 coding downstream 133046 2427507 ~ 2435639 (-)
CI01000053_02694095_02694625 DUSP14 coding upstream 124470 2693398 ~ 2696172 (-)
CI01000053_02716472_02737494 TADA2A coding upstream 147084 2716012 ~ 2737577 (-)
CI01000053_02739707_02746533 NA coding upstream 170566 2739494 ~ 2746582 (-)
CI01000053_02753283_02763401 NA coding upstream 184150 2753078 ~ 2763797 (-)
CI01000053_02817187_02856529 TRAF4A, TRAF4 coding upstream 246938 2815866 ~ 2856648 (-)
G226833 NA non-coding downstream 956 2567473 ~ 2567729 (-)
G226829 NA non-coding downstream 5322 2560910 ~ 2563363 (-)
G226719 NA non-coding downstream 246634 2321795 ~ 2322051 (-)
G226545 NA non-coding downstream 364417 2201825 ~ 2204268 (-)
G226862 NA non-coding upstream 24392 2593320 ~ 2595466 (-)
G226847 NA non-coding upstream 143259 2712187 ~ 2715746 (-)
G226848 NA non-coding upstream 179650 2748578 ~ 2751192 (-)
G226906 NA non-coding upstream 196185 2765113 ~ 2765353 (-)
G226826 NA other downstream 1613 2565892 ~ 2567072 (-)
CI01000053_02225226_02226481 YPELD, YPEL2B, YPEL1, YPELC, YPEL2 other downstream 331289 2225210 ~ 2226481 (-)
G225812 NA other downstream 1101953 1459595 ~ 1466732 (-)
G225574 NA other downstream 2021817 543647 ~ 546868 (-)
G226963 NA other upstream 427789 2996717 ~ 2997268 (-)
CI01000053_03551506_03551965 NA other upstream 981405 3550333 ~ 3552847 (-)
G227604 NA other upstream 1518309 4087237 ~ 4087740 (-)
G228651 NA other upstream 3215555 5784483 ~ 5787690 (-)
G228750 NA other upstream 3362664 5931592 ~ 5932241 (-)

Expression



Co-expression Network